View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2505_low_33 (Length: 239)

Name: NF2505_low_33
Description: NF2505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2505_low_33
NF2505_low_33
[»] chr8 (1 HSPs)
chr8 (1-180)||(3419557-3419739)


Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 3419557 - 3419739
Alignment:
1 ccagaaaacacatctcattgtcgttgtcataattggggaccacattatctgcattctta-tattattaataaaaatggcatttacttgattattttggtt 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||    
3419557 ccagaaaacacatctcattgtcgttgtcataattggggaccacattatctgcattcttattattattaatataaatggcatttacttgattattttggtt 3419656  T
100 attctct--nnnnnnnnntgattattttggttacgttacttaattaaataaaaaagaccgcaacaccctatacttttctaaca 180  Q
    |||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3419657 attctctcaaaaaaaaattgattattttggttacgttacttaattaaataaaaaagaccgcaacaccctatacttttctaaca 3419739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University