View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2506_low_12 (Length: 220)
Name: NF2506_low_12
Description: NF2506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2506_low_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 46 - 220
Target Start/End: Complemental strand, 54947390 - 54947214
Alignment:
| Q |
46 |
ctatggttactcttttttagaagaaaa--ataataataacatttaaagatttctatttatttgtacaacttttggagacnnnnnnnnnnnnnnnnnnnnn |
143 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54947390 |
ctatggttactcttttttagaagaaaataataataatcacatttaaagatttctatttatttgtacaacttttggagacaagaaaataataaggaaaaaa |
54947291 |
T |
|
| Q |
144 |
ctttaaatgaaattaccgtcaaaagcttgaagtaattttataataaaaatatcacttttatatagtttcattcaaac |
220 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54947290 |
ctttaaatgaaattaccgtcaaaagtttgaagtaattttataataaaaatatcacttttatatagtttcattcaaac |
54947214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 11750115 - 11750067
Alignment:
| Q |
161 |
gtcaaaagcttgaagtaattttataataaaaatatcacttttatatagtt |
210 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
11750115 |
gtcaaaagattgaagtaattttgtaataaaaaaatca-ttttatatagtt |
11750067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 161 - 198
Target Start/End: Original strand, 27155060 - 27155097
Alignment:
| Q |
161 |
gtcaaaagcttgaagtaattttataataaaaatatcac |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
27155060 |
gtcaaaagattgaagtaattttataataaaaaaatcac |
27155097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University