View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2506_low_5 (Length: 274)
Name: NF2506_low_5
Description: NF2506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2506_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 2 - 264
Target Start/End: Original strand, 53453632 - 53453894
Alignment:
| Q |
2 |
gcattgattcatcaccggaggaagatgaacatgttgtgaacttttctgctttaacaaatgctgatgaaaacgaattaccagaagttaaaataaacccaaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| | ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53453632 |
gcattgattcatcaccggaggaagatgaaaatgttgtggatttttctgttttaacaaatgctgatgaaaacgaattaccagaagtaaaaataaacccaaa |
53453731 |
T |
 |
| Q |
102 |
cgacgtggttgcgttaccgttttcttcaggaacttctggtttaccaaaaggtgttatgttaacacatgaaaatttagttacaacaatatcacagttagtt |
201 |
Q |
| |
|
||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53453732 |
cgatgtagttgcgttaccgttttcttcaggaacttctggtttaccaaaaggtgttatgttaacacatgaaaatttagttacaacaatatcacagttagtt |
53453831 |
T |
 |
| Q |
202 |
gacggtgaaaatccacaccaatacactaactacgaagatgtcttactttgtgtgttacctatg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53453832 |
gacggtgaaaatccacaccaatacactaactacgaagatgtcttactttgtgtgttacctatg |
53453894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University