View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2507_low_17 (Length: 229)

Name: NF2507_low_17
Description: NF2507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2507_low_17
NF2507_low_17
[»] chr3 (2 HSPs)
chr3 (100-217)||(50609332-50609449)
chr3 (12-101)||(50609494-50609583)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 100 - 217
Target Start/End: Complemental strand, 50609449 - 50609332
Alignment:
100 ttaaaatgacaaacggttcagttcggtttgaattgctccatgaaaatctaatctgatcaaaagcaatttggattagactgattcatttgattttatgatg 199  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50609449 ttaaaatgacaaacggttcagttcggtttgaattgcttcatgaaaatctaatctgatcaaaagcaatttggattagactgattcatttgattttatgatg 50609350  T
200 gtacatttatactatgtc 217  Q
    ||| ||||||||||||||    
50609349 gtatatttatactatgtc 50609332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 12 - 101
Target Start/End: Complemental strand, 50609583 - 50609494
Alignment:
12 agaatatggtggttgtgcctgtgtcagagtgctctacttgtaaataccccaatgacaaagttattggatgaatttggggtgtttgtggtt 101  Q
    |||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50609583 agaaaatggtggttgtgcctgtgtcagtgtgctctacttgtaaataccccaatgacaaagttattggatgaatttggggtgtttgtggtt 50609494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University