View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2507_low_17 (Length: 229)
Name: NF2507_low_17
Description: NF2507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2507_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 100 - 217
Target Start/End: Complemental strand, 50609449 - 50609332
Alignment:
| Q |
100 |
ttaaaatgacaaacggttcagttcggtttgaattgctccatgaaaatctaatctgatcaaaagcaatttggattagactgattcatttgattttatgatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50609449 |
ttaaaatgacaaacggttcagttcggtttgaattgcttcatgaaaatctaatctgatcaaaagcaatttggattagactgattcatttgattttatgatg |
50609350 |
T |
 |
| Q |
200 |
gtacatttatactatgtc |
217 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
50609349 |
gtatatttatactatgtc |
50609332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 12 - 101
Target Start/End: Complemental strand, 50609583 - 50609494
Alignment:
| Q |
12 |
agaatatggtggttgtgcctgtgtcagagtgctctacttgtaaataccccaatgacaaagttattggatgaatttggggtgtttgtggtt |
101 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50609583 |
agaaaatggtggttgtgcctgtgtcagtgtgctctacttgtaaataccccaatgacaaagttattggatgaatttggggtgtttgtggtt |
50609494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University