View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2507_low_22 (Length: 211)
Name: NF2507_low_22
Description: NF2507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2507_low_22 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 22 - 211
Target Start/End: Complemental strand, 31312400 - 31312211
Alignment:
| Q |
22 |
caaaacatcattgattctgttggttataatgacatatgtgataaccatttatcatttactactaagagcatgtcccaacaacgttgtgctacatagaaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31312400 |
caaaacatcattgattctgttggttataatgacatatgtgataaccatttatcatttactactaagagcatgtcccaacaacgttgtgctacatagaaga |
31312301 |
T |
|
| Q |
122 |
gttgataaaaggtttgtattgtgtgtgttagtgtttgcaacaatagtgcaattgattttgactgatgctggtattcgtcttgcagttact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31312300 |
gttgataaaaggtttgtattgtgtgtgttagtgtttgcaacaatagtgcaattgattttgactgatgctggtattcgtcttgcagttact |
31312211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 96
Target Start/End: Original strand, 36770807 - 36770871
Alignment:
| Q |
32 |
ttgattctgttggttataatgacatatgtgataaccatttatcatttactactaagagcatgtcc |
96 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| |||| ||||| ||||||| |||| |||||||| |
|
|
| T |
36770807 |
ttgattctgttggttatcatgacttatgtgacaaccctttattgtttactattaagggcatgtcc |
36770871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University