View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2508_high_11 (Length: 238)
Name: NF2508_high_11
Description: NF2508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2508_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 154
Target Start/End: Original strand, 40921395 - 40921530
Alignment:
| Q |
18 |
ggttttggttttgtctaggtactcggcagattgctgctgttataaccactgttttggccacaggtttattggctttttgcttgctgttaggggcctgtta |
117 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40921395 |
ggttttggttttgtctaggtgctcagcagaatgctgctgttataaccactgttt-ggccgcaggtttattggctttttgcttgctgttaggggcctgttg |
40921493 |
T |
|
| Q |
118 |
tgtgggtagttatagttgttatagcagcagttaggtg |
154 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40921494 |
tgtgggtggttatagttgttatagcagcagttaggtg |
40921530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University