View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2508_low_5 (Length: 319)
Name: NF2508_low_5
Description: NF2508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2508_low_5 |
 |  |
|
| [»] scaffold0586 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 134 - 306
Target Start/End: Original strand, 21481663 - 21481839
Alignment:
| Q |
134 |
ccactgtttggcaattcttgtttttt-cctaatcatgaatcaatgcnnnnnnnnggttagagacaacttgtttttattaacccaccttc---taactttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21481663 |
ccactgtttggcaattcttgtttttttcccaatcatgaatcaatgcaaaaaaaagtttagagacaacttgtttttattaacccaccttcttctaactttt |
21481762 |
T |
 |
| Q |
230 |
cccaaaatatgctaataaccatgacgctgaattctttgttcgtaaaacttcagcatgtgctagtaataaccaataag |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21481763 |
cccaaaatatgctaataaccatgacgctgaattctttgttcgtaaaacttcagcatgtgctagtaataaccaataag |
21481839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 21481527 - 21481564
Alignment:
| Q |
1 |
tactcaacatagatttggtgattgatatcaattctctg |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21481527 |
tactcaacatagatttggtgattgatatcaattctctg |
21481564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 116; Significance: 5e-59; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 134 - 312
Target Start/End: Original strand, 26661746 - 26661926
Alignment:
| Q |
134 |
ccactgtttggcaattcttgttttttcctaatcatgaatcaatgcnnnnnnnnggttagagacaacttgtttttattaacccaccttc---taacttttc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
26661746 |
ccactgtttggcaattcttgttttttcccaatcatgaatcaatg-aaaaaaaaggttagagacaacttgtttttattaaaccaccttcttctaacttttt |
26661844 |
T |
 |
| Q |
231 |
ccaaaatatgctaataaccatgacgctgaattctttgttcgtaaaacttcagcatgtgctagtaataaccaataagtctgtg |
312 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26661845 |
ccaaaatatgctaataaccataacgctgaattctttgttcgtaaaacttcagcatgtgctagtaataaccaataagcctgtg |
26661926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 26661609 - 26661646
Alignment:
| Q |
1 |
tactcaacatagatttggtgattgatatcaattctctg |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26661609 |
tactcaacatagatttggtgattgatatcaattctctg |
26661646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 6050014 - 6050043
Alignment:
| Q |
1 |
tactcaacatagatttggtgattgatatca |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6050014 |
tactcaacatagatttggtgattgatatca |
6050043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0586 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0586
Description:
Target: scaffold0586; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 9694 - 9731
Alignment:
| Q |
1 |
tactcaacatagatttggtgattgatatcaattctctg |
38 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
9694 |
tactcaacatagatttggtgatttatatcatttctctg |
9731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 10637749 - 10637786
Alignment:
| Q |
1 |
tactcaacatagatttggtgattgatatcaattctctg |
38 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
10637749 |
tactcaacatagatttggtgatttatatcatttctctg |
10637786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 32717845 - 32717808
Alignment:
| Q |
1 |
tactcaacatagatttggtgattgatatcaattctctg |
38 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
32717845 |
tactcaacatagatttggtgatttatatcatttctctg |
32717808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 13893726 - 13893697
Alignment:
| Q |
1 |
tactcaacatagatttggtgattgatatca |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13893726 |
tactcaacatagatttggtgattgatatca |
13893697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 22893904 - 22893941
Alignment:
| Q |
1 |
tactcaacatagatttggtgattgatatcaattctctg |
38 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
22893904 |
tactcaacatagatttggtgatttatatcatttctctg |
22893941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University