View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2509_high_13 (Length: 239)
Name: NF2509_high_13
Description: NF2509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2509_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 8375265 - 8375474
Alignment:
| Q |
16 |
ggcagatggtgaggtcatgcccttggaatgggttctatgcggtggcttcccaagaatctgttgcaactttaatttctgtttcttcttcttggataagacg |
115 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
8375265 |
ggcagatggtgagctcacgcccttggaatgggttctatgcggtggcttcccaagaatctgttgcagttttaatttctgtttcttcttcttgaataagacg |
8375364 |
T |
 |
| Q |
116 |
ggtgtgaaaggagcttaaactaatttcttatcatactctttgattcattgccataggtccatgtcttgttgaattattggattgttgtgttgtttacaac |
215 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8375365 |
ggtgtgaaaggagcttcagctaatttcttatcatactctttgattcattgccataggtccatgtcttgttgaattattggattgttgtgttgttcacaac |
8375464 |
T |
 |
| Q |
216 |
tctctccttg |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
8375465 |
tctctccttg |
8375474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University