View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2509_high_15 (Length: 228)
Name: NF2509_high_15
Description: NF2509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2509_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 52865258 - 52865471
Alignment:
| Q |
1 |
tagtttaaccgttagttttagcaatcaaattcaactttttagcttatccattagtggtagagcttcgtcaagatgttaggagtgataaacactaactaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
52865258 |
tagtttaaccgttagttttagcaatcaaattcaactttttagcttatccattagtggtagagcttcgtcaagatgttaggagtgacaaacactaact-aa |
52865356 |
T |
 |
| Q |
101 |
aatatttagatggtctaatctcaaataaaacgaatatgaatcgggtaggtgcgaacaagnnnnnnntgtatcatttaattatttaaaaaacgcattattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||| |
|
|
| T |
52865357 |
aatatttagatggtctaatctcaaataaaacgaatatgaatcgggtaggtgcgaacaagaaaaaaatatatcatttaattatttaaaaaatgcattattt |
52865456 |
T |
 |
| Q |
201 |
gattctttcttctac |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52865457 |
gattctttcttctac |
52865471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University