View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2509_low_11 (Length: 249)
Name: NF2509_low_11
Description: NF2509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2509_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 12164180 - 12164407
Alignment:
| Q |
16 |
taataataatttcattcattcaaattaaaatcattgaacacaaacaagtcggtggataataatagtaataagaaaacagaaagctgaggaatcaaagcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12164180 |
taataataatttcattcattcaaattaaaatcaatgaacacaaacaagtcggtggataataatagtaataagaaaacagaaagctgaggaaccaaagcat |
12164279 |
T |
 |
| Q |
116 |
gcatttcacctctcatatgtcacacatccctagattagaggtgactgatatgaaaagtcaagctttatattataaataaaattaccctaaatatattctt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12164280 |
gcatttcacctctcatatgtcacacatccctagattagaggtgactgatatgaaaagtcaagctttatattataaataaaattaccctaaatatattctt |
12164379 |
T |
 |
| Q |
216 |
ttgtcttctttcacaaatttcatctcac |
243 |
Q |
| |
|
||||||||||||| |||||||||||||| |
|
|
| T |
12164380 |
ttgtcttctttcataaatttcatctcac |
12164407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University