View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2509_low_15 (Length: 241)
Name: NF2509_low_15
Description: NF2509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2509_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 23 - 225
Target Start/End: Complemental strand, 12163883 - 12163681
Alignment:
| Q |
23 |
tctaggttaattgagaacatgatcagaggctgtaaaatagtgatgataatgcagaattcattaataatgtaatatgtcatcaaaacctagcacatattct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12163883 |
tctaggttaattgagaacatgatcagaggctgtaaaatagtgatgataatgcagaattcattaataatgtaatatgtcatcaaaacctagcacatattct |
12163784 |
T |
 |
| Q |
123 |
ctatacatatcaacccaaaaccttaaggaattggagaatatgggctatctattttatatatcaaacattttgtttattcatagttgatggatgactagtt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12163783 |
ctatacatatcaacccaaaaccttaaggaattggagaatacgggctatctattttatatatcaaacattttgtttattcatagttgatggaagactagtt |
12163684 |
T |
 |
| Q |
223 |
act |
225 |
Q |
| |
|
||| |
|
|
| T |
12163683 |
act |
12163681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University