View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2509_low_16 (Length: 239)

Name: NF2509_low_16
Description: NF2509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2509_low_16
NF2509_low_16
[»] chr5 (1 HSPs)
chr5 (16-225)||(8375265-8375474)


Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 8375265 - 8375474
Alignment:
16 ggcagatggtgaggtcatgcccttggaatgggttctatgcggtggcttcccaagaatctgttgcaactttaatttctgtttcttcttcttggataagacg 115  Q
    ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||| ||||||||    
8375265 ggcagatggtgagctcacgcccttggaatgggttctatgcggtggcttcccaagaatctgttgcagttttaatttctgtttcttcttcttgaataagacg 8375364  T
116 ggtgtgaaaggagcttaaactaatttcttatcatactctttgattcattgccataggtccatgtcttgttgaattattggattgttgtgttgtttacaac 215  Q
    |||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
8375365 ggtgtgaaaggagcttcagctaatttcttatcatactctttgattcattgccataggtccatgtcttgttgaattattggattgttgtgttgttcacaac 8375464  T
216 tctctccttg 225  Q
    ||||||||||    
8375465 tctctccttg 8375474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University