View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2509_low_18 (Length: 236)
Name: NF2509_low_18
Description: NF2509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2509_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 44838345 - 44838539
Alignment:
| Q |
18 |
ctgttgaatctgcttccatgatttctcagaatctccaaggatgatagatattgtggcatcttctgaatattgttttctaaaggttttggaattggaactt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44838345 |
ctgttgaatctgcttccatgatttctcagaatctccaaggatgatagatattgtggcatcttctgaatattgttttctaaaggttttggaattggaactt |
44838444 |
T |
 |
| Q |
118 |
tgtggtgaagattcttttgttgatcagtttctaagttgatattgatatcttctaataatgacatgaaattacaaacttcgaattcttgttgttgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44838445 |
tgtggtgaagattcttttgttgatcagtttctaagttgatattgatatcttctaataatgacatgaaattacaaacttcgaattcttgttgttgt |
44838539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University