View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2509_low_20 (Length: 230)
Name: NF2509_low_20
Description: NF2509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2509_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 111 - 214
Target Start/End: Original strand, 7802430 - 7802533
Alignment:
| Q |
111 |
gcacaccaacacaacatttgaataaagggcacaaataaattgacnnnnnnnttgattatagtacctgacaaaacaaaattactttagcccagaaaggtac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7802430 |
gcacaccaacacaacatttgaataaagggcacaaataaattaacaaaaaaattgattatagtacctgacaaaacaaaattactttagcccagaaaggtac |
7802529 |
T |
 |
| Q |
211 |
taag |
214 |
Q |
| |
|
|||| |
|
|
| T |
7802530 |
taag |
7802533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 7802320 - 7802373
Alignment:
| Q |
1 |
aacccaaacatgaatattgaataccttaaaaaacacaaatcccccatttcttta |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7802320 |
aacccaaacatgaatattgaataccttaaaaaacacaaatcccccatttcttta |
7802373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University