View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2509_low_8 (Length: 323)
Name: NF2509_low_8
Description: NF2509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2509_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 5 - 286
Target Start/End: Complemental strand, 7801882 - 7801589
Alignment:
| Q |
5 |
taagtggtgatgatgatgtgccttctttctgtcattccatgtgtgctagccttttcatagtagctatggtgttaattataatcacaatgcaacctcaatc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801882 |
taagtggtgatgatgatgtgccttctttctgtcattccatgtgtgctagccttttcatagtagctatggtgttaattataatcacaatgcaacctcaatc |
7801783 |
T |
 |
| Q |
105 |
tgggctgcagannnnnnnnnn-----------atgttggtgaaaccacaatgcaaccatgattaagggtgcaattgactgtgattttccgtaatat--ac |
191 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
7801782 |
tgggctgcagttttttttttttttttttttttatgttggtgaaacctcaatgcaaccatgattaagggcgcaattgactgtgattttccgtaatatcaac |
7801683 |
T |
 |
| Q |
192 |
gattgcgatgtgcaaccatagcaagtttctgtatttggaattttctatctaaaaagttcattgattattgcaaatatgccaaccgtagcaagttt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801682 |
gattgcgatgtgcaaccatagcaagtttctgtatt-ggaattttctatctaaaaagttcgttgattattgcaaatatgccaaccgtagcaagttt |
7801589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University