View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2510_high_20 (Length: 241)
Name: NF2510_high_20
Description: NF2510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2510_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 34123768 - 34123992
Alignment:
| Q |
1 |
ataatactcttttcagcgaacacttagcattatgcacccacaatgctaaaatcaacattcacacccattttttgtgcactagcgcccaaacgaaaaccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34123768 |
ataatactcttttcagcgaacacttagcattatgcacccacaatgctaaaatcaacattcacacccattttttgtgcactagcgcccaaaccaaaaccat |
34123867 |
T |
|
| Q |
101 |
caacccgcgtcatcacaaatactttttcaaacagcacaccaactgttcgacaaaactcctcactcaaaaacaacccaaccatcaccccttcttcagctta |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34123868 |
caacccgcgtaatcacaaatactttttcaaacagcacatcaactgttcgacaaaactcctcactcaaaaacaacccaaccatcaccccttcttcagctta |
34123967 |
T |
|
| Q |
201 |
cattcacctccctttctgtcgtaaa |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34123968 |
cattcacctccctttctgtcgtaaa |
34123992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University