View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2510_low_20 (Length: 252)
Name: NF2510_low_20
Description: NF2510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2510_low_20 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 40 - 252
Target Start/End: Original strand, 37022695 - 37022907
Alignment:
| Q |
40 |
tcaatttagggttttgactttaaatctcctattttttgtgtgtatttatggtgcttaattgcttgaatttttgattaattgtttgaaattatttatttac |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37022695 |
tcaatttagggttttgactttaaatctcctattttttgtgtgtatttatggtgtttaattgcttgaatttttgattaattgtttgaaattatttatttac |
37022794 |
T |
|
| Q |
140 |
agtatgcacggtgttgggattggaagagggcaaggaatgtgttattgttggaacactgtttaaaaatatgaagttgaagccttgtatacttgatgagtat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37022795 |
agtatgcacggtgttgggattggaagagggcaaggaatgtgttattgttggaacactgtttaaaaatatgaagttgaagccttgtatacttgatgagtat |
37022894 |
T |
|
| Q |
240 |
tctaaggaggtaa |
252 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
37022895 |
tctaagcaggtaa |
37022907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University