View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2511_low_7 (Length: 284)
Name: NF2511_low_7
Description: NF2511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2511_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 53086197 - 53086131
Alignment:
| Q |
1 |
caatttattaattatcttgttgtttctataaatttattttccggctattttcttatgataaaagcaa |
67 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
53086197 |
caatttgttaattatcttattgttactataaatttattttccggctattcttttatgataaaagcaa |
53086131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 94 - 131
Target Start/End: Complemental strand, 22583509 - 22583472
Alignment:
| Q |
94 |
ataatcatggacatatcatgtttgcttaagcttataaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22583509 |
ataatcatggacatatcatgtttgcttaagcttataaa |
22583472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 95 - 131
Target Start/End: Complemental strand, 22588339 - 22588303
Alignment:
| Q |
95 |
taatcatggacatatcatgtttgcttaagcttataaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22588339 |
taatcatggacatatcatgtttgcttaagcttataaa |
22588303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University