View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_high_41 (Length: 274)
Name: NF2512_high_41
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 14680281 - 14680518
Alignment:
| Q |
1 |
tttcattatgatcaaaggctctcttgcctaaggaccataataacccaattctaaataagtttatgttcttaagttatgtcatattacaggtgctaattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14680281 |
tttcattatgatcaaaggctctcttgcctaaggaccataataacccaattctaaataagtttatgttcttaagttatgtcatattacaggtgctaattat |
14680380 |
T |
 |
| Q |
101 |
gaagataaacaatggcattttaatgtgatctagttcaatcaccagttgaacaaacacattactatacttcattcaactcaatttgatttatgaattcatg |
200 |
Q |
| |
|
|| ||||| |||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14680381 |
gatgataagcaatggtattttaatgtgatgtagctcaatcaccagttgaacaaacacattactatacttcattcaactcaatttgatttatgaattcatg |
14680480 |
T |
 |
| Q |
201 |
gtacaactacagcccatgaagtaaattgttttggtcca |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14680481 |
gtacaactacagcccatgaagtaaattgttttggtcca |
14680518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 169 - 226
Target Start/End: Complemental strand, 14683422 - 14683365
Alignment:
| Q |
169 |
tcattcaactcaatttgatttatgaattcatggtacaactacagcccatgaagtaaat |
226 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14683422 |
tcattcaactcaatttgatatatgaattcatggtacaactacagcccatgaagtaaat |
14683365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 5 - 99
Target Start/End: Complemental strand, 14683668 - 14683570
Alignment:
| Q |
5 |
attatgatcaaaggctctcttgcctaagga----ccataataacccaattctaaataagtttatgttcttaagttatgtcatattacaggtgctaatta |
99 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| |||||| |||||||| |||||| ||||||||||||||| |||||||| ||||||| | ||||||| |
|
|
| T |
14683668 |
attatgattaaaagctctcttgcctaaggaaggaccataacaacccaatgctaaatgagtttatgttcttaatttatgtcagattacagtttctaatta |
14683570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University