View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_high_48 (Length: 250)
Name: NF2512_high_48
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_high_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 162 - 240
Target Start/End: Complemental strand, 9564031 - 9563953
Alignment:
| Q |
162 |
ttgtgtactggttgtttctagtacggtgtttttctgtacttggctctctttccggttacgccttgttatcatataacgg |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9564031 |
ttgtgtacttgttgtttctagtacggtgttttactgtacttggctctctttccggttacgccttgttatcatataacgg |
9563953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 9564170 - 9564131
Alignment:
| Q |
19 |
ccattgtcaaggcatatttgtcgtgttgcttaaaggaaca |
58 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9564170 |
ccattgtcaaggcatatttgtcttgttgcttaaaggaaca |
9564131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University