View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_high_49 (Length: 250)
Name: NF2512_high_49
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_high_49 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 30194637 - 30194397
Alignment:
| Q |
10 |
aagaatatacatctctctctgacatcatatcaaaaatgtgttgagcagctttaagatcaccacacttgcaatacatgtcaatcagtgaattcccaactaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30194637 |
aagaatatacatctctctctgacatcatatcaaaaatgtgttgagcagctttaagatcaccacacttgcaatacatgtcaatcagtgaattaccaactaa |
30194538 |
T |
 |
| Q |
110 |
tacattgtcgaccaatttcatcttaacagcaatagaatgtatttctaatcccatactcaatgattttaaggctgcacatgctgaggcagcacttgcaatt |
209 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30194537 |
tacattgtcgaccaaattcatcttaacagcaatagaatgtatttctaatcccatactcaatgattttaaggctgcacatgctgaggcagcacttgcaatt |
30194438 |
T |
 |
| Q |
210 |
gtaatgttattggcctcaacaccagctaaaaacatctcttt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30194437 |
gtaatgttattggcctcaacaccagctaaaaacatctcttt |
30194397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University