View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2512_high_62 (Length: 236)

Name: NF2512_high_62
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2512_high_62
NF2512_high_62
[»] chr1 (1 HSPs)
chr1 (1-157)||(30882274-30882430)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 30882430 - 30882274
Alignment:
1 ccactacttaacaacaatgcattttatggcagagaatagagatggcgggttaaaattgtggatttttggctttctgccatcgatgacactaattaaaaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30882430 ccactacttaacaacaatgcattttatggcagagaatagagatggcgggttaaaattgtggatttttggctttctgccatcgatgacactaattaaaaca 30882331  T
101 acaaaaacaatagtttcacttggtaaggttagctacaagatcaaacaatgtcaaata 157  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30882330 acaaaaacaatagtttcacttggtaaggttagctacaagatcaaacaatgtcaaata 30882274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University