View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_high_63 (Length: 236)
Name: NF2512_high_63
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_high_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 119 - 222
Target Start/End: Complemental strand, 49126936 - 49126833
Alignment:
| Q |
119 |
tataatttatgcttgccgagtagagaaacatgtcaaccaatggcgtgccactaagcttcactattgttgaatatttggaagattctttgttcttgggaaa |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49126936 |
tataatttatgcttgccgagttgagaaacatgtcaaccaatggcgtgccactaagcttcactattgttgaatatttggaagattctttgttcttgggaaa |
49126837 |
T |
 |
| Q |
219 |
aact |
222 |
Q |
| |
|
|||| |
|
|
| T |
49126836 |
aact |
49126833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 49127335 - 49127234
Alignment:
| Q |
19 |
tttctaaatttgttatgttttggtaatgattcaataaatttgatttatcataccaataataatactagaaagttaatgaaagagttaatgctttgtaatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
49127335 |
tttctaaatttgttatgttttggtaatgattcaataaatttgatttatcataccaataataatactaaaatgttaatgaaagagttaatgctttgtaatt |
49127236 |
T |
 |
| Q |
119 |
ta |
120 |
Q |
| |
|
|| |
|
|
| T |
49127235 |
ta |
49127234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University