View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_high_67 (Length: 223)
Name: NF2512_high_67
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_high_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 207
Target Start/End: Complemental strand, 35441348 - 35441155
Alignment:
| Q |
14 |
catagggatacaaatgcagtaatccagcttcagaagtcatcttctgactggctggaacatgtagagtctaacttattggacagaaaatttaaatcaaggt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
35441348 |
catagggatacaaatgcagtaatccagcttcagaagtcatcttctgactggctggaacatgtagagtctaactgattggatagaaaatttaaatcaaggt |
35441249 |
T |
|
| Q |
114 |
tacggaatctcagtggcattatctttgatggagacaaaggtggtgttgttgatgcagactcgactcctacattcttcttttctgccttcttttt |
207 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35441248 |
tacggaatctcagtggcactatctttgatggagacaaaggtggtgttgttgatgcagactcaactcctacattcttcttttctgccttcttttt |
35441155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University