View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2512_high_71 (Length: 215)

Name: NF2512_high_71
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2512_high_71
NF2512_high_71
[»] chr1 (1 HSPs)
chr1 (17-136)||(30882274-30882393)


Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 17 - 136
Target Start/End: Complemental strand, 30882393 - 30882274
Alignment:
17 agagatggcgggttaaaattgtggatttttggctttctgccatcgatgacactaattaaaacaacaaaaacaatagtttcacttggtaaggttagctaca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30882393 agagatggcgggttaaaattgtggatttttggctttctgccatcgatgacactaattaaaacaacaaaaacaatagtttcacttggtaaggttagctaca 30882294  T
117 agatcaaacaatgtcaaata 136  Q
    ||||||||||||||||||||    
30882293 agatcaaacaatgtcaaata 30882274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University