View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_low_21 (Length: 418)
Name: NF2512_low_21
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_low_21 |
 | |
|
| [»] scaffold0450 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0450 (Bit Score: 129; Significance: 1e-66; HSPs: 3)
Name: scaffold0450
Description:
Target: scaffold0450; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 41 - 192
Target Start/End: Complemental strand, 11274 - 11118
Alignment:
| Q |
41 |
acccatttaagttttctaaagacaccta-----tagaccttggaacatctcatacacatgcctatatctagtgcaatgttttatgaagtttaaatttctc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
11274 |
acccatttaagttttctaaagacacctagtgtatagaccttggaacatctcatacacatgcctatatctaatgcaatgttttatgaagttttaatttctc |
11175 |
T |
|
| Q |
136 |
ccatatactttgacttcttgttgtgaccctagctgattttgtaaagaaggaatgtct |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11174 |
ccatatactttgacttcttgttgtgaccctagctgattttgtaaagaaggaatgtct |
11118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0450; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 311 - 414
Target Start/End: Complemental strand, 11000 - 10897
Alignment:
| Q |
311 |
taatgataggcaccagacaaatagaaaaccctaaccaacaaaagcaggggaaacaacaggtacacaaccagaatgttgacaaaaaggaacaagtaatatc |
410 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
11000 |
taatgataggcacctgacaaatagaaaaccctaaccaacaaaagcaggagaaacaacaagtacacaaccagaatgttgacaaaaaggaaaaagtaatctc |
10901 |
T |
|
| Q |
411 |
tctg |
414 |
Q |
| |
|
|||| |
|
|
| T |
10900 |
tctg |
10897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0450; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 213 - 249
Target Start/End: Complemental strand, 11095 - 11059
Alignment:
| Q |
213 |
aggtgagtgcaagtttgcaaggagtacaagaagtatt |
249 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11095 |
aggtgactgcaagtttgcaaggagtacaagaagtatt |
11059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 3 - 34
Target Start/End: Original strand, 23666430 - 23666461
Alignment:
| Q |
3 |
atattgctcaaggttcctttggatgtataaat |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23666430 |
atattgctcaaggttcctttggatgtataaat |
23666461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University