View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_low_23 (Length: 391)
Name: NF2512_low_23
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_low_23 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 174 - 391
Target Start/End: Original strand, 4421316 - 4421533
Alignment:
| Q |
174 |
gccttaggtgaaggagagatggaatcaatatccaccgacacggaatcggtaggtgttgaatcagccataagtgaattgagaaacgcgattatggaaaata |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4421316 |
gccttaggtgaaggagagatggaatcaatatccaccgacacggaatcggtaggtgttgaatcagccataagtgaattgagaaacgcgattatggaaaata |
4421415 |
T |
|
| Q |
274 |
agtttgaatatagaatcgcttattctgcgttttgcgtttgcgtttgcgtttggaaatgcatttagttatatggcattgggggaagaaagaaagaaagaaa |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4421416 |
agtttgaatatagaatcgcttattctgcgttttgcgtttgcgtttgcgtttggaaatgcagttagttatatggcattgggggaagaaagaaagaaagaaa |
4421515 |
T |
|
| Q |
374 |
taatcgcgtttgttttct |
391 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4421516 |
gaatcgcgtttgttttct |
4421533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University