View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_low_43 (Length: 260)
Name: NF2512_low_43
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_low_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 29838331 - 29838580
Alignment:
| Q |
1 |
ccatgtctaatgcttggtatgaggtgttgtcggttttgcatttgatgtcaatgctattactgtcaaaggctaatttgctgctgcttccaagatcatccag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838331 |
ccatgtctaatgcttggtatgaggtgttgtcggttttgcatttgatgtcaatgctattactgtcaaaggctaatttgctgctgcttccaagatcatccag |
29838430 |
T |
 |
| Q |
101 |
tgacggtcatcagcagagagtatcagatggtatgtaccaagtaatactacaaaatgattggtaaatgcttgcaaatcgtgtataaatggtgacaaccgcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29838431 |
tgacggtcatcagcagagagtatcagatggtatgtaccaagtaatactacaaaaagattggtaaatgcttgcaaatcgcgtataaatggtgacaaccgcg |
29838530 |
T |
 |
| Q |
201 |
taataacttgacattatcaaatgatcttgtttcttctgtgtgcttctgtg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838531 |
taataacttgacattatcaaatgatcttgtttcttctgtgtgcttctgtg |
29838580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 34628274 - 34628143
Alignment:
| Q |
1 |
ccatgtctaatgcttggtatgaggtgttgtcggttttgcatttgatgtcaatgctattactgtcaaaggctaatttgctgctgcttccaagatcatccag |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||| || ||||| |||||| ||| ||||| || ||| |||||||||| | || ||||||||| |||||| |
|
|
| T |
34628274 |
ccatgtctaatgcttggtatgaagtgttgtcagtcttgcacttgatggcaacactattgctatcacaggctaatttattacttcttccaagaacatccac |
34628175 |
T |
 |
| Q |
101 |
tgacggtcatcagcagagagtatcagatggta |
132 |
Q |
| |
|
|| |||||||||| | ||||||||| |||| |
|
|
| T |
34628174 |
cgatggtcatcagccaaaagtatcagaaggta |
34628143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University