View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_low_46 (Length: 253)
Name: NF2512_low_46
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_low_46 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 45955238 - 45954996
Alignment:
| Q |
18 |
atcaactatctttccctcctttagcttcttctctttctgatttcaatggagcaagacttcaaactcaaattcaggttctacactcttttcattctctcta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45955238 |
atcaactatctttccctcctttagcttcttctctttctgatttcaatggagcaagacttcaaactcatattcaggttctacactcttttcattctctcta |
45955139 |
T |
 |
| Q |
118 |
tttacacatcataatcactttcatttcatgcattgcaatcacaatgttgatgctacata---gacgttgcttgataaatacttgtat-----tttgtctt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||| |
|
|
| T |
45955138 |
tttacacatcataatcactttcatttcatgcattgcaatcacaatgttgatgctacatagacgacgttgcttgatcaatacttgtattttaatttgtctt |
45955039 |
T |
 |
| Q |
210 |
gttgagttgagctgactagactatataatactctcgaaataatt |
253 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45955038 |
gttgagttgagctgactagactatat-atactctcgaaataatt |
45954996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University