View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2512_low_48 (Length: 250)

Name: NF2512_low_48
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2512_low_48
NF2512_low_48
[»] chr3 (2 HSPs)
chr3 (162-240)||(9563953-9564031)
chr3 (19-58)||(9564131-9564170)


Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 162 - 240
Target Start/End: Complemental strand, 9564031 - 9563953
Alignment:
162 ttgtgtactggttgtttctagtacggtgtttttctgtacttggctctctttccggttacgccttgttatcatataacgg 240  Q
    ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
9564031 ttgtgtacttgttgtttctagtacggtgttttactgtacttggctctctttccggttacgccttgttatcatataacgg 9563953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 9564170 - 9564131
Alignment:
19 ccattgtcaaggcatatttgtcgtgttgcttaaaggaaca 58  Q
    |||||||||||||||||||||| |||||||||||||||||    
9564170 ccattgtcaaggcatatttgtcttgttgcttaaaggaaca 9564131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University