View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_low_50 (Length: 249)
Name: NF2512_low_50
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_low_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 32 - 236
Target Start/End: Original strand, 45955554 - 45955757
Alignment:
| Q |
32 |
taatggctaagataatgtcacaagctaagacaatatacatcggaaatttagaaaggaagcgttgttaaggcttttacttacaattttggttcccatattt |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45955554 |
taatggctaagataatgtcacaagctaagacaatatacatcggaaatttagaaaggaagcgttgtta-ggcttttacttacaattttggttcccatattt |
45955652 |
T |
|
| Q |
132 |
taaaaccattagtttaaattcataagatttttgtatttaaaaatggtgaaactaagtttttcattggttttctggtattactttttaggggtggttttct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45955653 |
taaaaccattagtttaaattcataagatttttgtatttaaaaatggtgaaactaagtttttcattggttttctggtattactttttaggggtggttttct |
45955752 |
T |
|
| Q |
232 |
tgtat |
236 |
Q |
| |
|
||||| |
|
|
| T |
45955753 |
tgtat |
45955757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 45955502 - 45955535
Alignment:
| Q |
1 |
aattcatgcttcagattgtagacctataaaataa |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45955502 |
aattcatgcttcagattgtagacctataaaataa |
45955535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University