View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_low_59 (Length: 237)
Name: NF2512_low_59
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_low_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 36058063 - 36057891
Alignment:
| Q |
1 |
tttggagaaaagaatgtatatcgcctctaatatcgtggaataattcatgaacagagaattctattttctgtta----aaaatatataattctatttaaac |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||| || ||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
36058063 |
tttggagaaaagaatgtatatcgcctctaataccgtggaacaattcatcaatagagaattctattttctgttaaaaaaaaatagataattctatttaaac |
36057964 |
T |
|
| Q |
97 |
tatgaaaattatcatgaggacacatgtttgatgataacaaaga-tttgttggacatgtgattatgatggtatt |
168 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
36057963 |
tatgaaaattatcatgaggatacatgtttgatgatgacaaagactttgttggatatgtgattttgatggtatt |
36057891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 164 - 219
Target Start/End: Complemental strand, 36057819 - 36057765
Alignment:
| Q |
164 |
gtattgttaatgttttgttctaatattgcttttaaccacacaatagtcacaactaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36057819 |
gtattgttaatgttttgttctaatatt-cttttaaccacacaatagtcacaactaa |
36057765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 83 - 168
Target Start/End: Original strand, 36055721 - 36055805
Alignment:
| Q |
83 |
aattctatttaaactatgaaaattatcatgaggacacatgtttgatgataacaaaga-tttgttggacatgtgattatgatggtatt |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||| ||| ||| |||||||||| || |||| |||||||||| |
|
|
| T |
36055721 |
aattctatttaaactatgaaaattatcatgacg--acatgtttgatgatgacagagactttgttggacttgcgattttgatggtatt |
36055805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University