View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_low_61 (Length: 236)
Name: NF2512_low_61
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 28 - 124
Target Start/End: Original strand, 36529678 - 36529774
Alignment:
| Q |
28 |
taaaagcatgttgcttttatagggagtaaaaaataatttaacattttatttatgacaagaatagaaaaggaaatggtatactgtagcttcttttcct |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36529678 |
taaaagcatgttgcttttatagggagtaaaaaataatttaacattttatttatgacaagaatagaaaaggaaatggtatactgtagcttcttttcct |
36529774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 190 - 221
Target Start/End: Original strand, 36529840 - 36529871
Alignment:
| Q |
190 |
caggttcttagttttgtacatttacatgtcct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36529840 |
caggttcttagttttgtacatttacatgtcct |
36529871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University