View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_low_62 (Length: 236)
Name: NF2512_low_62
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 30882430 - 30882274
Alignment:
| Q |
1 |
ccactacttaacaacaatgcattttatggcagagaatagagatggcgggttaaaattgtggatttttggctttctgccatcgatgacactaattaaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30882430 |
ccactacttaacaacaatgcattttatggcagagaatagagatggcgggttaaaattgtggatttttggctttctgccatcgatgacactaattaaaaca |
30882331 |
T |
|
| Q |
101 |
acaaaaacaatagtttcacttggtaaggttagctacaagatcaaacaatgtcaaata |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30882330 |
acaaaaacaatagtttcacttggtaaggttagctacaagatcaaacaatgtcaaata |
30882274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University