View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2512_low_68 (Length: 222)
Name: NF2512_low_68
Description: NF2512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2512_low_68 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 81 - 144
Target Start/End: Original strand, 39675236 - 39675300
Alignment:
| Q |
81 |
tagaggggaggtgggatgtaattagat-aacctcatggaaggttaatgtaatttacccttaaatt |
144 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| || || ||||||||||||||||| ||||| |
|
|
| T |
39675236 |
tagaggggaggtgggatgtaattagataaacctcaagggagtttaatgtaatttaccctaaaatt |
39675300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Complemental strand, 39675008 - 39674962
Alignment:
| Q |
16 |
aaacttgaattcaagatgtagaagaagaatcatgaaacgatggaaat |
62 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
39675008 |
aaacttgaaatcaagatgtagaactagaatcatgaaacgattgaaat |
39674962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University