View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2513_high_28 (Length: 209)
Name: NF2513_high_28
Description: NF2513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2513_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 14 - 171
Target Start/End: Original strand, 8443846 - 8444002
Alignment:
| Q |
14 |
ataattctcataacctccataaaaaagcttctttataaggtatctcnnnnnnnnnctttcttggtacaatctttatggagaattttatgtaatcattata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8443846 |
ataattctcataacctccataaaaaagcttctttataaggtatc-ccttttttttctttcttggtacaatctttatggagaattttatgtaatcattata |
8443944 |
T |
 |
| Q |
114 |
ctcgagttctagctgaactaaaaattttaaaataaaattgattattttttggtaatgg |
171 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8443945 |
ctcgagttctagctgaactaaaaaatttaaaataaaattgattattttttggtaatgg |
8444002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University