View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2513_low_19 (Length: 280)
Name: NF2513_low_19
Description: NF2513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2513_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 10 - 203
Target Start/End: Original strand, 30193591 - 30193784
Alignment:
| Q |
10 |
attattcttatgttcatggttttaataatcacaatattgcaggacgatcatcaaccacggatcgattagctcttgagcttgagttgaggaataatcatca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30193591 |
attattcttatgttcatggttttaataatcacaatattgcaggacgatcatcaaccacggatcgattagctcttgagcttgagttgaggaataatcatca |
30193690 |
T |
|
| Q |
110 |
tggaaacacaaacatgattgcaactagtggtggtgatcatcatcatcattattatccacatccaatggtaccttaaaatataatgatactaatg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30193691 |
tggaaacacaaacatgattgcaactagtggtggtgatgatcatcatcattattatccacatccaatggtaccttaaaatataatgatactaatg |
30193784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University