View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2513_low_25 (Length: 242)
Name: NF2513_low_25
Description: NF2513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2513_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 12817236 - 12817463
Alignment:
| Q |
1 |
tttgatgtactttagatattatttaacgaattgaggatgcaatttgccacttgaagttttcaagtaagaatggaaaatgaggccaatgtaatgttgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12817236 |
tttgatgtactttagatattatttaatgaattgaggatgcaatttgccacttgaagttatcaagtaagaatggaaaatgaggccaatgtaatgttgttgt |
12817335 |
T |
 |
| Q |
101 |
ctttctaaaagaaaaataactactttgttgcacgcaaaaaataatttaagatcactactatagttttaactaaattataatttgagtgtggttaaaaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12817336 |
ctttctaaaagaaaaataactactttgttgcacgcaaaaaataatttaagatcactactatagttttaactaaattataatttgagtgtggttaaaaatt |
12817435 |
T |
 |
| Q |
201 |
tactattttatcgttcaattgaaaaaat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
12817436 |
tactattttatcgttcaattgaaaaaat |
12817463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University