View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2513_low_26 (Length: 239)
Name: NF2513_low_26
Description: NF2513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2513_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 10049817 - 10049592
Alignment:
| Q |
1 |
gactcacacaaatcaaaaactcaaaagcattaactgtgcggtcacttaccacatcaaattcatttccataactgtgtgtggaatctattaaaatttattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10049817 |
gactcacacaaatcaaaaactcaaaagcattaactgtgtggtcacttaccacatcaaattcatttccataactgtgtgtggaatctattaaaatttattg |
10049718 |
T |
 |
| Q |
101 |
tgaatctcgcaatatattaggatatagtt--agcaatgtgaaaaattaccaatgtgcttctcctgctgacggaacttgtaggagtgactcccatctgaat |
198 |
Q |
| |
|
|||||||| |||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10049717 |
tgaatctcacaatatattaggatatagatacagc-atgtgaaaaattaccaatgtgcttctcctgctgacggaacttgtaggagtgactcccatctgaaa |
10049619 |
T |
 |
| Q |
199 |
tttcaatttcaaaatcaatgttaatca |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
10049618 |
tttcaatttcaaaatcaatgttaatca |
10049592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University