View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2514_high_9 (Length: 246)
Name: NF2514_high_9
Description: NF2514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2514_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 7220801 - 7220752
Alignment:
| Q |
1 |
ctaccgagagggagtgtgttgatgtccttctaagattcaataggcaatgg |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7220801 |
ctaccgagagggagtgtgttgatgtccttctaagattcaataggcgatgg |
7220752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 43
Target Start/End: Complemental strand, 26308211 - 26308180
Alignment:
| Q |
12 |
gagtgtgttgatgtccttctaagattcaatag |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26308211 |
gagtgtgttgatgtccttctaagattcaatag |
26308180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 42
Target Start/End: Original strand, 24119240 - 24119270
Alignment:
| Q |
12 |
gagtgtgttgatgtccttctaagattcaata |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24119240 |
gagtgtgttgatgtccttctaagattcaata |
24119270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 43
Target Start/End: Original strand, 24752189 - 24752219
Alignment:
| Q |
13 |
agtgtgttgatgtccttctaagattcaatag |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24752189 |
agtgtgttgatgtccttctaagattcaatag |
24752219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 10504212 - 10504168
Alignment:
| Q |
1 |
ctaccgagagggag--tgtgttgatgtccttctaagattcaatag |
43 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
10504212 |
ctaccgagagggagagtgtgttgatgtctttctaagattcaatag |
10504168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 43
Target Start/End: Complemental strand, 32759033 - 32759004
Alignment:
| Q |
14 |
gtgtgttgatgtccttctaagattcaatag |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32759033 |
gtgtgttgatgtccttctaagattcaatag |
32759004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 30694943 - 30694987
Alignment:
| Q |
1 |
ctaccgagagggag--tgtgttgatgtccttctaagattcaatag |
43 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
30694943 |
ctaccgagagggagaatatgttgatgtccttctaagattcaatag |
30694987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University