View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2514_low_20 (Length: 225)
Name: NF2514_low_20
Description: NF2514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2514_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 16623 - 16816
Alignment:
| Q |
16 |
atgatattggccgtcaaccacgacatgagaaacttatttaattcaataatctattacccttatacatattgttgaatgcagtaaaaattataataaatga |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16623 |
atgatattggctgtcaaccacgacatgagaaacttatttaattcaataatcttttacccttatacatattgttgaatgcagtaaaaattataataaatga |
16722 |
T |
|
| Q |
116 |
caccaacggtacttaagtatcatagagttttttagcgagcaacaattaattgttgttaaagcgaacgatggttaattgtcgctagaggtatttc |
209 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16723 |
caccaacggtacttaagtatcgtagagttttttagcgagcaacagttaattgttgttaaagcgaacgatggttaattgtcgatagaggtatttc |
16816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 45 - 153
Target Start/End: Complemental strand, 8234 - 8126
Alignment:
| Q |
45 |
aaacttatttaattcaataatctattacccttatacatattgttgaatgcagtaaaaa--ttataataaatgacaccaacggtacttaagtatcatagag |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||| ||| ||||| ||||||||||||||||| |||| || |
|
|
| T |
8234 |
aaacttatttaattcaataatctattaccc--atacatattgttgaatgcagaaaaaaaattagaatgaatgataccaacggtacttaagtgtcatgaag |
8137 |
T |
|
| Q |
143 |
ttttttagcga |
153 |
Q |
| |
|
||||||||||| |
|
|
| T |
8136 |
ttttttagcga |
8126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University