View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2515_low_15 (Length: 244)
Name: NF2515_low_15
Description: NF2515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2515_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 33825166 - 33825398
Alignment:
| Q |
1 |
tatttgcatatatatgctaacaacagatccatttcttatcagttatcacaggaattgtgctatgaaggaggtctaagttgcagaagtaagtgagctc--c |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33825166 |
tatttgcatatatatgctaacaacagatccatttcttatcagttatcacaggaattgtgctatgaaggaggtctaagttgcagaagtaagtgagctctcc |
33825265 |
T |
|
| Q |
99 |
acaggatcagcagcattctttgtgtaggagtggtggtattctctactaatatcttaaggcattaagtgttagaatttttgttgacttccttttgagcaaa |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33825266 |
acaggaacagcagcattctttgtgtaggagtggtggtattctctactaatatcttaaggcattaagtgttagaatttttgttgacttccttttgagcaaa |
33825365 |
T |
|
| Q |
199 |
gttaaatttaacctatgtagtagaaagaaagtg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33825366 |
gttaaatttaacctatgtagtagaaagaaagtg |
33825398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University