View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2515_low_17 (Length: 239)
Name: NF2515_low_17
Description: NF2515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2515_low_17 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 7974208 - 7973988
Alignment:
| Q |
19 |
tcactaacatctccaacagccttaaccacatgacccaaaaacttcttcctattctcagcatacacgtgtccatcccatccacgcttcaccaaatcaccac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
7974208 |
tcactaacatctccaacagccttaaccacatgacccaaaaacttcttcctattctcagcatacacgtgtccatcccatccacgtttcaccaaattaccac |
7974109 |
T |
|
| Q |
119 |
ccaactcaaccgcagccttaaccgtttcctcagcactatcatgcgccgagtcaatgattcctaatcttaccgcctccttcgctgtcaccttcgccgcctg |
218 |
Q |
| |
|
|||| |||||||||||||||||||||||||| | ||||||||||||||||||| || || ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
7974108 |
ccaattcaaccgcagccttaaccgtttcctccacgctatcatgcgccgagtcaacaatccccaatctcaccgcctccttcgccgtcaccttcgccgcctg |
7974009 |
T |
|
| Q |
219 |
catcacaatcttcctcctcgc |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7974008 |
catcacaatcttcctcctcgc |
7973988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 45 - 228
Target Start/End: Original strand, 7966695 - 7966878
Alignment:
| Q |
45 |
cacatgacccaaaaacttcttcctattctcagcatacacgtgtccatcccatccacgcttcaccaaatcaccacccaactcaaccgcagccttaaccgtt |
144 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||| | |||||||||||||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
7966695 |
cacatgacccaaaagcttcttcctattctcagcatacacgtctccattcaatccacgcttcaccaaatcaccgctcaattcaaccgcagccttaaccgtt |
7966794 |
T |
|
| Q |
145 |
tcctcagcactatcatgcgccgagtcaatgattcctaatcttaccgcctccttcgctgtcaccttcgccgcctgcatcacaatc |
228 |
Q |
| |
|
|||||| | ||||||||||||||||||| ||| || ||||| |||||||||| || ||||||||| |||||| | |||||||| |
|
|
| T |
7966795 |
tcctcaacgctatcatgcgccgagtcaacgatccccaatctcaccgcctcctcagccgtcaccttctccgcctccgtcacaatc |
7966878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University