View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2515_low_9 (Length: 320)
Name: NF2515_low_9
Description: NF2515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2515_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 13 - 304
Target Start/End: Complemental strand, 46534883 - 46534592
Alignment:
| Q |
13 |
gaactggttataaattgcagggaatgttcaggagaatgataacaatatgtctctagacattcttaggaaagttgtttctgaaattgagacagggtttatt |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46534883 |
gaactggttataaattgcagggcatgttcaggagaatgataacaatatgtctctagacattcctaggaaagttgtttctgaaattgagacagggtttatt |
46534784 |
T |
|
| Q |
113 |
gagtttgcccgaagacattacgtgcaacatggtcaaccaaagattggtatagttagttcaggttgtctgatttgtatcatagagagaaggacattatatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46534783 |
gagtttgcccgaagacattacgtgcaacttggtcaaccaaagattggtatagttagttcaggttgtctgatttgtatcatagagagaaggacattatatc |
46534684 |
T |
|
| Q |
213 |
tcaccaacgttggagactcgcgcgctatacttggttctaagataggtattggtccatttaaaagactgtgtgttaagcaaatggctagagat |
304 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46534683 |
tcgccaacgttggagactcgcgcgctatacttggttctaagatgggtattggtccatttaaaagactgtgtgttaagcaaatggctagagat |
46534592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University