View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2516_low_11 (Length: 350)
Name: NF2516_low_11
Description: NF2516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2516_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 4136240 - 4136020
Alignment:
| Q |
1 |
ttaaaattgatcccatcagtttctttnnnnnnnnntcatcccaacagcttttagataaaaataaacaccaatcattaaccaaaataatttataaaatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4136240 |
ttaaaattgatcccatcagtttctttaaaaaaaaatcatcccatcagcttttagataaaaataaacaccaatcattaaccaaaataatttataaaatgtt |
4136141 |
T |
|
| Q |
101 |
ggtaatatttactaataatctt-gnnnnnnnaatacatattgcttgatgtaatatatacaatcaagttattatgtgttaataaaatgcaaattatttggg |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4136140 |
ggtaatatttactaataatcttattttttttaatacatattgcttgatgtaatatatacaatcaagttattatgtgttaataaaatgcaaattatttggg |
4136041 |
T |
|
| Q |
200 |
tttttattcctcttttatacc |
220 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
4136040 |
tttttggccctcttttatacc |
4136020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 338
Target Start/End: Complemental strand, 4136000 - 4135942
Alignment:
| Q |
280 |
aacttaaactcgagtatgaagatcttatatattccctccgttccaaattgcatgatatt |
338 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||| || |||||||| || ||||| |
|
|
| T |
4136000 |
aacttaaactcgagtatgaagatcttacatactccctatgtcccaaattgtataatatt |
4135942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University