View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2516_low_15 (Length: 250)
Name: NF2516_low_15
Description: NF2516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2516_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 179
Target Start/End: Original strand, 12431648 - 12431809
Alignment:
| Q |
18 |
gaatctgatggaacagcctcaaatcacaattaggggaacaactagaagccgctcacagagcaggtgatgcgaagaaactactctttggttagttataatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12431648 |
gaatctgatggaacagcctcaaatcacaattagaggaacaactagaagccgctcgcagagcaggtgatgcgaagaaactactctttggttagtaataatt |
12431747 |
T |
 |
| Q |
118 |
ttttgtatagtttgtattggttcatttgacctggattgttggatatctatgtacttctggaa |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| ||| |||| ||||| |
|
|
| T |
12431748 |
ttttgtatagtttgtattcgttcatttgacctggattgttggatatccatgcacttttggaa |
12431809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 177 - 250
Target Start/End: Original strand, 12432011 - 12432083
Alignment:
| Q |
177 |
gaagtgggcttacggtccaactcaaccccactaaatcagcttgttagacaatgactggtttataaggactacct |
250 |
Q |
| |
|
||||||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12432011 |
gaagtgggcttacagtctaactca-ccccactaaatcagcttgttagacaatgactggtttataaggactacct |
12432083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 52 - 137
Target Start/End: Original strand, 12413349 - 12413432
Alignment:
| Q |
52 |
ggaacaactagaagccgctcacagagcaggtgatgcgaagaaactactctttggttagttataattttttgtatagtttgtattgg |
137 |
Q |
| |
|
||||||||||||||| |||| |||||| |||||| |||||||||||||||||||||||| || |||||||| |||||||||||| |
|
|
| T |
12413349 |
ggaacaactagaagctgctcgtagagcaagtgatgtgaagaaactactctttggttagttcta--tttttgtaaagtttgtattgg |
12413432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University