View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2516_low_16 (Length: 242)
Name: NF2516_low_16
Description: NF2516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2516_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 9147000 - 9147207
Alignment:
| Q |
19 |
gggagaggaaggaaagaaaagtggttgttggttgcttccattctcagcnnnnnnnn-tataaatagaactaaaacttagaaagctcttttcgttacttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9147000 |
gggagaggaaggaaagaaaagtggttgttggttgcttccattctcagcaaaaaaaaatataaatagaactaaaacttagaaagctctttccgttacttct |
9147099 |
T |
 |
| Q |
118 |
attaactctactttcaacattctatatacacgcactacccaccaccatcttcattagtatagaaaaatgatgaaaatgggagggattattgttgtgatgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9147100 |
attaactctactttcaacattctatatacacgtactacccaccaccatcttcattagtatagaaaaatgatgaaaatgggagggattattgttgtgatgg |
9147199 |
T |
 |
| Q |
218 |
cggtggct |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
9147200 |
cggtggct |
9147207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University