View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2516_low_6 (Length: 428)
Name: NF2516_low_6
Description: NF2516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2516_low_6 |
 |  |
|
| [»] chr8 (83 HSPs) |
 |  |
|
| [»] chr7 (86 HSPs) |
 |  |
|
| [»] chr5 (71 HSPs) |
 |  |
|
| [»] chr4 (108 HSPs) |
 |  |
|
| [»] chr2 (83 HSPs) |
 |  |
|
| [»] chr1 (95 HSPs) |
 |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |
|
| [»] chr6 (66 HSPs) |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |
|
| [»] scaffold1619 (1 HSPs) |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] scaffold0350 (1 HSPs) |
 |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 1e-85; HSPs: 87)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 34899547 - 34899335
Alignment:
| Q |
1 |
cttagcagacacttcttcatagannnnnnnngttgaagaagtcaaaaattatattaaacgaaaaagagatcccaataaatacaagttgagtttaagaagg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899547 |
cttagcagacacttcttcatagattttttttgttgaagaagtcaaaaattatattaaacgaaaaagagatcccaataaatacaagttgagtttaagaagg |
34899448 |
T |
 |
| Q |
101 |
atccaaatagcaccacaagaaacaattagagaagtgtcaaaacaaaagggnnnnnnnnttcattgatgaattgtatagccctgatttttaaaattgagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34899447 |
atccaaatagcaccacaagaaacaattagagaagtgtcaaaacaaaagggaaaaaaaattcattgatgaattgtatagccctgatttttagaattgagca |
34899348 |
T |
 |
| Q |
201 |
agactcttctgat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34899347 |
agactcttctgat |
34899335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 254 - 428
Target Start/End: Complemental strand, 34899294 - 34899121
Alignment:
| Q |
254 |
tactataataactagttttttacaaggttaaaataaacgtatctgtaaacttatgttgaaattttacaaatgtagagccattttatttttattaaacgat |
353 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
34899294 |
tactataataaccagttttttacgaggttaaaataaacgtatctgtaaacttatgttgaaattttataaatgtagaaccattctatttttattaaacgat |
34899195 |
T |
 |
| Q |
354 |
gttcggcaactatgtgannnnnnnnngttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899194 |
gttcggcaactatgtga-ttttttttgttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
34899121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 4332660 - 4332702
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4332660 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
4332702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 7464482 - 7464528
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7464482 |
tggtggtcggggtttgaaccccggaccttacatatattatgcattgt |
7464528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 8238634 - 8238588
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8238634 |
tggtggccggagtttgaaccccagaccttgcatatattatgcattgt |
8238588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 25727958 - 25728004
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25727958 |
tggtggtcgggatttgaaccccggaccttgcatatattatgcattgt |
25728004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 38130950 - 38130996
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38130950 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
38130996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 48022305 - 48022351
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
48022305 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcattgt |
48022351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 48849754 - 48849800
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48849754 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
48849800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 24348455 - 24348411
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
24348455 |
gtggtcggagtttgaacctctgaccttgcatatattatgcattgt |
24348411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 31214704 - 31214660
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
31214704 |
tggtggtcggagtttgaatcccggaccttacatatattatgcatt |
31214660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 41817558 - 41817523
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41817558 |
gtttgaaccccggaccttgcatatattatgcattgt |
41817523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 45432007 - 45431972
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45432007 |
gtttgaaccccggaccttgcatatattatgcattgt |
45431972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 48656901 - 48656936
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48656901 |
gtttgaaccccggaccttgcatatattatgcattgt |
48656936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 393 - 427
Target Start/End: Original strand, 913602 - 913636
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattg |
427 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
913602 |
gtttgaaccccggaccttgcatatattatgcattg |
913636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 4601914 - 4601868
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4601914 |
tggtggccggggtttgaaccccggaccttgcatttattatgcattgt |
4601868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 390 - 428
Target Start/End: Original strand, 7626460 - 7626498
Alignment:
| Q |
390 |
ggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7626460 |
ggagtttgaaccccggaccttgcatattttatgcattgt |
7626498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 10922299 - 10922345
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10922299 |
tggtagtcggggtttgaaccccggatcttgcatatattatgcattgt |
10922345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 21628881 - 21628923
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
21628881 |
gtggtcggagtttgaaccccggacgttggatatattatgcatt |
21628923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 22722472 - 22722426
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
22722472 |
tggtggtcggggtttgaacctcggaccttgcatattttatgcattgt |
22722426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 25340915 - 25340961
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25340915 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
25340961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 25441491 - 25441537
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25441491 |
tggtggccggggtttgaaccccagaccttgcatatattatgcattgt |
25441537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 28430556 - 28430602
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
28430556 |
tggtggtcagagtttgaacctcagaccttgcatatattatgcattgt |
28430602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 39779094 - 39779048
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39779094 |
tggtggttggggtttgaaccccgaaccttgcatatattatgcattgt |
39779048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 394 - 428
Target Start/End: Original strand, 40575612 - 40575646
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40575612 |
tttgaaccccggaccttgcatatattatgcattgt |
40575646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 42372588 - 42372546
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
42372588 |
gtggtcggagtttgaaccccggaccttggatatatcatgcatt |
42372546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 45334259 - 45334213
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45334259 |
tggtggtcgggatttgaaccccgaaccttgcatatattatgcattgt |
45334213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 48315017 - 48315059
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48315017 |
gtggtcgggatttgaaccccggaccttgcatatattatgcatt |
48315059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 49975796 - 49975842
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49975796 |
tggtggttgaagtttgaaccccagaccttgcatatattatgcattgt |
49975842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 393 - 426
Target Start/End: Original strand, 16663238 - 16663271
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16663238 |
gtttgaaccccggaccttgcatatattatgcatt |
16663271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 334838 - 334882
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
334838 |
tggtggccggggtttgaaccccggaccttgcatattttatgcatt |
334882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 1111834 - 1111878
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
1111834 |
gtggtcggggtttgaaccccagaccttgcatatattatgtattgt |
1111878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 24120411 - 24120455
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
24120411 |
tggtgatcggagtttgaaccgcggatcttgcatatattatgcatt |
24120455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 425
Target Start/End: Original strand, 8136623 - 8136666
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
8136623 |
tggtggtcggggtttgaaccttggaccttgcatatattatgcat |
8136666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 16792976 - 16793011
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16792976 |
gtttgaaccctggaccttgcatatattatgcattgt |
16793011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 28266771 - 28266740
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28266771 |
gaaccccggaccttgcatatattatgcattgt |
28266740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 421
Target Start/End: Complemental strand, 33930409 - 33930370
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
33930409 |
tggtggtcagagtttaaaccccggaccttgcatatattat |
33930370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 42403134 - 42403091
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggacc-ttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
42403134 |
gtggtcggagtttgaaccccggacctttggatatattatgcatt |
42403091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 428
Target Start/End: Original strand, 46226015 - 46226062
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||| ||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
46226015 |
ttggtgttcggggttcgaactccggaccttgcatatattatgcattgt |
46226062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 428
Target Start/End: Complemental strand, 46903971 - 46903932
Alignment:
| Q |
389 |
cggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
46903971 |
cggagtttgaaccctggaccttacatatattatgcattgt |
46903932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 428
Target Start/End: Original strand, 47536478 - 47536517
Alignment:
| Q |
389 |
cggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
47536478 |
cggagtttgaacctcggaccttgcatattttatgcattgt |
47536517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Original strand, 49082703 - 49082746
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| || |||||| |
|
|
| T |
49082703 |
tggtcggggtttgaaccccggaccttgcatatatcatacattgt |
49082746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 428
Target Start/End: Complemental strand, 49710783 - 49710744
Alignment:
| Q |
389 |
cggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
49710783 |
cggagtttgaactccggaccttgcatattttatgcattgt |
49710744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 424
Target Start/End: Complemental strand, 552240 - 552202
Alignment:
| Q |
386 |
ggtcggagtttgaaccccggaccttgcatatattatgca |
424 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
552240 |
ggtcggggtttgaaccctggaccttgcatatattatgca |
552202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 916509 - 916463
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
916509 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
916463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Original strand, 977944 - 977978
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
977944 |
tttgaactccggaccttgcatatattatgcattgt |
977978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 4825409 - 4825363
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4825409 |
tggtggtcgaggttcgaaccccggacctttcatatattatgcattgt |
4825363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 383 - 428
Target Start/End: Original strand, 5293636 - 5293682
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcata-tattatgcattgt |
428 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
5293636 |
ggtggtcggaggttgaaccacggaccttgcatattattatgcattgt |
5293682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 8075855 - 8075809
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
8075855 |
tggtggccggggtttgaacctcagaccttgcatatattatgcattgt |
8075809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 10440754 - 10440708
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| || ||||| || ||||||||||||||||||||||| |
|
|
| T |
10440754 |
tggtggtcggaattcgaacctcgtaccttgcatatattatgcattgt |
10440708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Complemental strand, 10926527 - 10926493
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10926527 |
tttgaaccccgaaccttgcatatattatgcattgt |
10926493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 11358304 - 11358258
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
11358304 |
tggtggccggggtttgaaccccggatcttgcatatattatgaattgt |
11358258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 12699996 - 12700042
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
12699996 |
tggtggccggagtttgaaccccggactttacatattttatgcattgt |
12700042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 17755191 - 17755145
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
17755191 |
tggtggtcggaatttgaaccccgaaccttacatatattatgtattgt |
17755145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 19056511 - 19056465
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
19056511 |
tggtggtcggaatttgaaccccgaaccttacatatattatgtattgt |
19056465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 27185547 - 27185501
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
27185547 |
tggtggtcgaggtttgaaccccagaccttgcatatattatgtattgt |
27185501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 28244095 - 28244141
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| |||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
28244095 |
tggtgatcggggttcgaaccccggaccttgcatattttatgcattgt |
28244141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 29631256 - 29631210
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
29631256 |
tggtggccggggtttgaatcccgaaccttgcatatattatgcattgt |
29631210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 30050419 - 30050465
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||| || | ||||||||||||||||||||| |
|
|
| T |
30050419 |
tggtggccggagtttgaaccgcgaatcttgcatatattatgcattgt |
30050465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 32629150 - 32629104
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
32629150 |
tggtggtcgatgttcgaaccccggaccttgcatattttatgcattgt |
32629104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 32843253 - 32843299
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
32843253 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgt |
32843299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 35347288 - 35347330
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
35347288 |
gtggtcgaggtttgaaccccagaccttgcatatattatgcatt |
35347330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 44075147 - 44075193
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
44075147 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
44075193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 45727559 - 45727513
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
45727559 |
tggtggtcggagtttgaaccctaaaccttgcatacattatgcattgt |
45727513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 48796209 - 48796255
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
48796209 |
tggtggccggggtttgaaccccgaaccttgcatatcttatgcattgt |
48796255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 48944347 - 48944392
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
48944347 |
tggtggtcggagtttgaa-ccctgatcttgcatatattatgcattgt |
48944392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 390 - 428
Target Start/End: Complemental strand, 50037373 - 50037335
Alignment:
| Q |
390 |
ggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
50037373 |
ggagtttgaaccccgaaccttgcatacattatgcattgt |
50037335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 51882191 - 51882237
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
51882191 |
tggtggccggggtttgaaccctggatcttgcatatattatgcattgt |
51882237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 52119446 - 52119400
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgt |
52119400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 395 - 428
Target Start/End: Complemental strand, 7738726 - 7738693
Alignment:
| Q |
395 |
ttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
7738726 |
ttgaaccccggaccttgcatattttatgcattgt |
7738693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 388 - 428
Target Start/End: Complemental strand, 26941764 - 26941723
Alignment:
| Q |
388 |
tcggagtttgaaccccggaccttgcatatatt-atgcattgt |
428 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
26941764 |
tcggagtttgaaccccgaaccttgcatatattaatgcattgt |
26941723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 391 - 428
Target Start/End: Complemental strand, 32753889 - 32753852
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
32753889 |
gagtttgaaccccgggccttgtatatattatgcattgt |
32753852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 384 - 425
Target Start/End: Complemental strand, 33490330 - 33490289
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
||||||||||||||||| |||||| ||| ||||||||||||| |
|
|
| T |
33490330 |
gtggtcggagtttgaactccggactttgtatatattatgcat |
33490289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 42074172 - 42074127
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| ||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
42074172 |
ggtggccggagttcgaacctcagaccttgcatatattatgcattgt |
42074127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 387 - 428
Target Start/End: Complemental strand, 48517736 - 48517695
Alignment:
| Q |
387 |
gtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
48517736 |
gtcggagtttgaactccgaaccttgtatatattatgcattgt |
48517695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 382 - 423
Target Start/End: Original strand, 51812576 - 51812617
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgc |
423 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
51812576 |
tggtggtcgtggtttgaaccccgtaccttgcatatattatgc |
51812617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 986946 - 986990
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
986946 |
gtggtcggggtttgaaccctggaccttgcatattttatacattgt |
986990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 392 - 428
Target Start/End: Complemental strand, 2078300 - 2078264
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2078300 |
agtttgaaccccaaaccttgcatatattatgcattgt |
2078264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 11508476 - 11508520
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
11508476 |
gtggtcggggttcgaaccccggaccctgcatatatcatgcattgt |
11508520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 20612270 - 20612314
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20612270 |
gtggccggggtttgaaccccaaaccttgcatatattatgcattgt |
20612314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 22251451 - 22251495
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
22251451 |
tggtggccggggttcgaaccccggaccgtgcatatattatgcatt |
22251495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 29164744 - 29164788
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
29164744 |
tggtggtcggggtttgaaccccagactttgcatatattatacatt |
29164788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 34442440 - 34442484
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
34442440 |
gtggccggggtttgaaccccggaccttacatattttatgcattgt |
34442484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 42276389 - 42276433
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| |||| |||| |
|
|
| T |
42276389 |
tggtgttcggagtttgaaccccgaaccttgcatattttatacatt |
42276433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 47040887 - 47040931
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||| ||||| |||| |||||||||||| |
|
|
| T |
47040887 |
gtggtcggagcttgaaccccgaaccttacatacattatgcattgt |
47040931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 394 - 426
Target Start/End: Original strand, 47099038 - 47099070
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
47099038 |
tttgaaccccgaaccttgcatatattatgcatt |
47099070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 428
Target Start/End: Complemental strand, 48511302 - 48511274
Alignment:
| Q |
400 |
ccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48511302 |
ccccggaccttgcatatattatgcattgt |
48511274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 7e-16; HSPs: 83)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 381 - 428
Target Start/End: Original strand, 27718884 - 27718931
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27718884 |
ttggtggtcggagtttgaactccggaccttgcatatattatgcattgt |
27718931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 12748971 - 12748925
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12748971 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
12748925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 12800891 - 12800937
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12800891 |
tggtggtcggggtttgaaccccggaccttgcatatattatgtattgt |
12800937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 19163527 - 19163573
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19163527 |
tggtggtcggggtttgaaccccggaccttgcataaattatgcattgt |
19163573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 32051523 - 32051569
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32051523 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
32051569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 33996139 - 33996093
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
33996139 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcattgt |
33996093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 37141427 - 37141381
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37141427 |
tggtggccggagtttgaaccccgaaccttgcatatattatgcattgt |
37141381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 24195318 - 24195273
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24195318 |
ggtgatcggagtttgaaccccggaccttgcatatattatgtattgt |
24195273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 24023408 - 24023452
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24023408 |
gtggtcggggtttgaaccccggaccttgcatattttatgcattgt |
24023452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 23159512 - 23159465
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
23159512 |
ttggtggtcggggtttgaaccccgaatcttgcatatattatgcattgt |
23159465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 381 - 428
Target Start/End: Original strand, 26196594 - 26196641
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
26196594 |
ttggtggccggagtttgaaccacgaaccttgcatatattatgcattgt |
26196641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 33105450 - 33105415
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33105450 |
gtttgaaccccggaccttgcatatattatgcattgt |
33105415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 444483 - 444437
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
444483 |
tggtggccggggtttaaaccccggaccttgcatatattatgcattgt |
444437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 7997010 - 7996964
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
7997010 |
tggtggtcggggtttgaaccccagaccttgcatatattatgcgttgt |
7996964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 8881345 - 8881299
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8881345 |
tggtggccggggtttgaaccctggaccttgcatatattatgcattgt |
8881299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 11709056 - 11709010
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
11709056 |
tggtggtcggggtttgaacttcggaccttgcatatattatgcattgt |
11709010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 12714362 - 12714407
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12714362 |
tggtggtcgga-tttgaaccccgaaccttgcatatattatgcattgt |
12714407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 14598189 - 14598235
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
14598189 |
tggtggtcggggtttgaaccccgcaccttgcttatattatgcattgt |
14598235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 18533739 - 18533693
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18533739 |
tggtggttggggtttgaaccccggatcttgcatatattatgcattgt |
18533693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 19260570 - 19260616
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19260570 |
tggtggccggggtttgaaccccggaccttacatatattatgcattgt |
19260616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 24838161 - 24838207
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24838161 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
24838207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 27134411 - 27134457
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
27134411 |
tggttgtcggagtttgaaccccggactttgcatatattatacattgt |
27134457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 27587291 - 27587245
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27587291 |
tggtggccggggtttgaaccccggaccttgcatatatcatgcattgt |
27587245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 29716691 - 29716737
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
29716691 |
tggtggccggagtttgaatcccggaccttgcatatattatgaattgt |
29716737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 35700386 - 35700432
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
35700386 |
tggtggtcggagtttgaaccccgaattttgcatatattatgcattgt |
35700432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 43778089 - 43778043
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
43778089 |
tggtggtcggagtttgaacctcagaccttgcatattttatgcattgt |
43778043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 8461829 - 8461873
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
8461829 |
gtggtcggggtttgaactccggaccttgcatattttatgcattgt |
8461873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 8999882 - 8999926
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
8999882 |
tggtggtcggggtttgaaccctggactttgcatatattatgcatt |
8999926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 11053044 - 11053000
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11053044 |
gtggtcggggttcaaaccccggaccttgcatatattatgcattgt |
11053000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 428
Target Start/End: Original strand, 22504287 - 22504327
Alignment:
| Q |
388 |
tcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
22504287 |
tcggagtttgaaccccgaaccttgcatattttatgcattgt |
22504327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 393 - 425
Target Start/End: Original strand, 30176421 - 30176453
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30176421 |
gtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 39138989 - 39139033
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
39138989 |
tggtggtcggagtttgaaccccgaaccttacatattttatgcatt |
39139033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 428
Target Start/End: Complemental strand, 7553742 - 7553703
Alignment:
| Q |
389 |
cggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7553742 |
cggagtttgaaccttggaccttgcatatattatgcattgt |
7553703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 8717477 - 8717512
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8717477 |
gtttgaaccccgaaccttgcatatattatgcattgt |
8717512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 10871896 - 10871931
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10871896 |
gtttgaaccccggaccttgcatacattatgcattgt |
10871931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 13124365 - 13124400
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13124365 |
gtttgaaccccggaccttgcatattttatgcattgt |
13124400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 19778120 - 19778089
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19778120 |
gaaccccggaccttgcatatattatgcattgt |
19778089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 22775687 - 22775652
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22775687 |
gtttgaaccccggaccttgcataaattatgcattgt |
22775652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 26799255 - 26799208
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
26799255 |
ttggtggtcggggttttaaccccgaaccttgcatattttatgcattgt |
26799208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 428
Target Start/End: Original strand, 27571839 - 27571886
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
27571839 |
ttggtggtcgggatttgaaccccaaaccttgcatatattatgcattgt |
27571886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 39821943 - 39821908
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39821943 |
gtttgaaccccagaccttgcatatattatgcattgt |
39821908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 42208471 - 42208506
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42208471 |
gtttgaacctcggaccttgcatatattatgcattgt |
42208506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 44794952 - 44794917
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44794952 |
gtttgaactccggaccttgcatatattatgcattgt |
44794917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 574454 - 574408
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
574454 |
tggtggtcgaagttcgaactccggaccttacatatattatgcattgt |
574408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 5179863 - 5179817
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| || ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
5179863 |
tggtggccgaagtttgaaccccgaaccttgtatatattatgcattgt |
5179817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 6038266 - 6038312
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
6038266 |
tggtggccggagtttgaactccagaccttacatatattatgcattgt |
6038312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Complemental strand, 6447247 - 6447213
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6447247 |
tttgaactccggaccttgcatatattatgcattgt |
6447213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 6471581 - 6471535
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
6471581 |
tggtggccggggtttgaaccccgaacattgcatatattatgcattgt |
6471535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 7987721 - 7987766
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
7987721 |
tggtggtcggaatttgaaccc-ggaccttgcatatattatgtattgt |
7987766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 8043940 - 8043894
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
8043940 |
tggtggttggagtttgaactccgaaccttgcatatattatgcgttgt |
8043894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 14279562 - 14279608
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
14279562 |
tggtggtcagagttcgaaccccgaaccttgcatattttatgcattgt |
14279608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 398 - 428
Target Start/End: Complemental strand, 15438507 - 15438477
Alignment:
| Q |
398 |
aaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15438507 |
aaccccggaccttgcatatattatgcattgt |
15438477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 398 - 428
Target Start/End: Complemental strand, 15529811 - 15529781
Alignment:
| Q |
398 |
aaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15529811 |
aaccccggaccttgcatatattatgcattgt |
15529781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 20665354 - 20665400
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
20665354 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
20665400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 398 - 428
Target Start/End: Original strand, 22948088 - 22948118
Alignment:
| Q |
398 |
aaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22948088 |
aaccccggaccttgcatatattatgcattgt |
22948118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 26932754 - 26932800
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
26932754 |
tggtggtcgtggtttgaaccctggaccttgcatatatcatgcattgt |
26932800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 29376971 - 29376925
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||||| ||||||| |
|
|
| T |
29376971 |
tggtggtcggggtttgaactccagaccttgcatatattacgcattgt |
29376925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 29652288 - 29652242
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
29652288 |
tggtggtcgaggtttgaactctggaccttgcatatattatgcattgt |
29652242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 30550717 - 30550763
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
30550717 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
30550763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 32944831 - 32944877
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
32944831 |
tggtggtcggggtttgaacctcagaccttgcatattttatgcattgt |
32944877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 33743645 - 33743599
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| || |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
33743645 |
tggtggccgaagtttgaacctcggaccttgcatattttatgcattgt |
33743599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 421
Target Start/End: Complemental strand, 40482404 - 40482370
Alignment:
| Q |
387 |
gtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40482404 |
gtcggagtttgaaccccggaccttgcatacattat |
40482370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 40795447 - 40795401
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||| ||||| |
|
|
| T |
40795447 |
tggtggccggaattagaaccccggaccttgcatatattatgtattgt |
40795401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 42172234 - 42172280
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| || |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
42172234 |
tggtggttggggtttgaactccggatcttgcatatattatgcattgt |
42172280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 44215466 - 44215512
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
44215466 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
44215512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 44632176 - 44632222
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
44632176 |
tggtggtcggggtttgaaccccgaaccttatatatattatgcattgt |
44632222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 8837988 - 8837944
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| |||||||| |||||||||||||||| |
|
|
| T |
8837988 |
ggtggtcggaatttgaaccc-ggaccttgtatatattatgcattgt |
8837944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 380 - 421
Target Start/End: Complemental strand, 29293249 - 29293208
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
29293249 |
gttggtggccggagtttgaactccggaccttacatatattat |
29293208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 387 - 428
Target Start/End: Original strand, 31336803 - 31336844
Alignment:
| Q |
387 |
gtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
31336803 |
gtcggggtttgaaccctagaccttgcatatattatgcattgt |
31336844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 387 - 428
Target Start/End: Complemental strand, 32192959 - 32192918
Alignment:
| Q |
387 |
gtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
32192959 |
gtcggggttcgaaccccgaaccttgcatatattatgcattgt |
32192918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 380 - 421
Target Start/End: Complemental strand, 32421640 - 32421600
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
32421640 |
gttggtggccgg-gtttgaaccccggaccttgcatatattat |
32421600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 34645078 - 34645123
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcata-tattatgcattgt |
428 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
34645078 |
gtggtcggggttcgaaccccggaccttgcatattattatgcattgt |
34645123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 36781477 - 36781432
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
36781477 |
ggtggtcggggtttaaaccccggactttgcatatattatgtattgt |
36781432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 381 - 426
Target Start/End: Original strand, 38826472 - 38826517
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||| |||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
38826472 |
ttggtagtcggagtttcaaccccgaaccttgcatttattatgcatt |
38826517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 391 - 428
Target Start/End: Original strand, 40919360 - 40919396
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40919360 |
gagtttgaaccc-ggaccttgcatatattatgcattgt |
40919396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 391 - 428
Target Start/End: Complemental strand, 44602658 - 44602621
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
44602658 |
gagttcgaactccggaccttgcatatattatgcattgt |
44602621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 392 - 428
Target Start/End: Complemental strand, 295933 - 295897
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
295933 |
agtttgaaccccagaccttgcatgtattatgcattgt |
295897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 3650590 - 3650546
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
3650590 |
tggtggccggggtttgaaccccgaaccttacatatattatgcatt |
3650546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 4830076 - 4830032
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
4830076 |
gtggtcgggattcgaaccccgaaccttgcatatattatgcattgt |
4830032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 422
Target Start/End: Original strand, 15147020 - 15147060
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
15147020 |
tggtggtcgggatttgagccccggaccttgcatatattatg |
15147060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 24023699 - 24023743
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | ||||| |||| |
|
|
| T |
24023699 |
tggtggtcggggtttgaaccccggaccttgcagacattatacatt |
24023743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 428
Target Start/End: Complemental strand, 30623357 - 30623317
Alignment:
| Q |
388 |
tcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
30623357 |
tcggggttcgaaccccagaccttgcatatattatgcattgt |
30623317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 392 - 428
Target Start/End: Complemental strand, 32285796 - 32285760
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
32285796 |
agtttgaacccggaaccttgcatatattatgcattgt |
32285760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 86)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 18023749 - 18023703
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18023749 |
tggtggtcggagtttgaaccctggaccttgcatatattatgcattgt |
18023703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 19599214 - 19599169
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19599214 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
19599169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 46371051 - 46371007
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46371051 |
tggtggtcggagtttgaaccccggaccttggatatattatgcatt |
46371007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 47342427 - 47342471
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47342427 |
gtggtcggagtttgaactccggaccttgcatatattatgcattgt |
47342471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 27462427 - 27462473
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27462427 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
27462473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 27833392 - 27833438
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27833392 |
tggtggtcggggtttgaaccccggaccttacatatattatgcattgt |
27833438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 42829225 - 42829271
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42829225 |
tggtggccggagtttgaaccccggagcttgcatatattatgcattgt |
42829271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 48629056 - 48629102
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48629056 |
tggtggtcggggtttaaaccccggaccttgcatatattatgcattgt |
48629102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 391 - 428
Target Start/End: Original strand, 39280818 - 39280855
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39280818 |
gagtttgaaccccggaccttgcatatattatgcattgt |
39280855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 7670502 - 7670458
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7670502 |
gtggtcgaggtttgaaccccggaccttgcatatattatgcattgt |
7670458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 19626518 - 19626562
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19626518 |
gtggccggtgtttgaaccccggaccttgcatatattatgcattgt |
19626562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 26717919 - 26717963
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26717919 |
tggtggtcagagtttgaaccctggaccttgcatatattatgcatt |
26717963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 382 - 422
Target Start/End: Original strand, 45046206 - 45046246
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45046206 |
tggtggtcagagtttgaaccccggaccttgcatatattatg |
45046246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 46737853 - 46737809
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46737853 |
gtggccggtgtttgaaccccggaccttgcatatattatgcattgt |
46737809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 10244786 - 10244751
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10244786 |
gtttgaaccccggaccttgcatatattatgcattgt |
10244751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 18714507 - 18714472
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
18714507 |
gtttgaaccccggaccttgcatatattatgcattgt |
18714472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 20085761 - 20085796
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20085761 |
gtttgaaccccggaccttgcatatattatgcattgt |
20085796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 420
Target Start/End: Complemental strand, 145588 - 145550
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatatta |
420 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
145588 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
145550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 3671894 - 3671848
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||||||||||||| |
|
|
| T |
3671894 |
tggtggtcggggtttgaactccagaccttgcatatattatgcattgt |
3671848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 424
Target Start/End: Complemental strand, 5579763 - 5579721
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgca |
424 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
5579763 |
tggtggtcggggtttgaaccccagaccttgcatatattatgca |
5579721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 18773747 - 18773793
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
18773747 |
tggtggtcggggtttgaaccccggaccttacatattttatgcattgt |
18773793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 19416584 - 19416538
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19416584 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
19416538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 28230849 - 28230803
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
28230849 |
tggtggtcggtgtttgaaccccggaccttgcatacatcatgcattgt |
28230803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 29053111 - 29053069
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
29053111 |
gtggtcggagtttgaaccccggaccttggatatattaagcatt |
29053069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 42227796 - 42227842
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
42227796 |
tggtggtcggagtttgaacctcgaaccttacatatattatgcattgt |
42227842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 390 - 424
Target Start/End: Original strand, 42753526 - 42753560
Alignment:
| Q |
390 |
ggagtttgaaccccggaccttgcatatattatgca |
424 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42753526 |
ggagtttgaaccccggaccttgcatatattatgca |
42753560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 45088945 - 45088900
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45088945 |
tggtggtcggggtttgaaccccg-accttgcatatattatgcattgt |
45088900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 383 - 428
Target Start/End: Original strand, 44868147 - 44868192
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
44868147 |
ggtggtcggaatttgaacctcggaccttacatatattatgcattgt |
44868192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 3536247 - 3536291
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
3536247 |
gtggtcggagtttgaatcccgaaccttacatatattatgcattgt |
3536291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 10242550 - 10242506
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
10242550 |
tggtgatcggggtttgaaccctggaccttgcatatattatgcatt |
10242506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 26529682 - 26529726
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
26529682 |
tggtggtcggggtttaaaccccgaaccttgcatatattatgcatt |
26529726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 392 - 428
Target Start/End: Complemental strand, 40867090 - 40867054
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40867090 |
agtttgaaccccggaccttgcatatactatgcattgt |
40867054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 393 - 425
Target Start/End: Original strand, 42095945 - 42095977
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42095945 |
gtttgaaccccggaccttgcatatattatgcat |
42095977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 422
Target Start/End: Original strand, 47607901 - 47607941
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
47607901 |
tggtggccggagtttgaaccctggaccttgcatatattatg |
47607941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 2618734 - 2618703
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2618734 |
gaaccccggaccttgcatatattatgcattgt |
2618703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 387 - 426
Target Start/End: Complemental strand, 2648337 - 2648298
Alignment:
| Q |
387 |
gtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
2648337 |
gtcggagttcgaaccctggaccttgcatatattatgcatt |
2648298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 3830127 - 3830092
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3830127 |
gtttgaaccctggaccttgcatatattatgcattgt |
3830092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 5041398 - 5041363
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5041398 |
gtttgaaccccagaccttgcatatattatgcattgt |
5041363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 421
Target Start/End: Original strand, 21327532 - 21327571
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21327532 |
tggtggtcggagtttgaaccccaaaccttgcatatattat |
21327571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Original strand, 23198743 - 23198786
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
23198743 |
tggtcggggtttgaaccccggactttgcatattttatgcattgt |
23198786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Complemental strand, 29726867 - 29726824
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
29726867 |
tggtcggggtttgaaccccgaaccttgcatatattatacattgt |
29726824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Complemental strand, 36755081 - 36755038
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
36755081 |
tggtcggagtttgaatcccgaaccttacatatattatgcattgt |
36755038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Complemental strand, 36760878 - 36760835
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
36760878 |
tggtcggagtttgaatcccgaaccttacatatattatgcattgt |
36760835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 43539106 - 43539141
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43539106 |
gtttgaaccccggaccttacatatattatgcattgt |
43539141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 46987141 - 46987110
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46987141 |
gaaccccggaccttgcatatattatgcattgt |
46987110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Original strand, 1079695 - 1079729
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1079695 |
tttgaaccccggaccttgcatattttatgcattgt |
1079729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 1285060 - 1285106
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
1285060 |
tggtggtcagagctcgaaccccggatcttgcatatattatgcattgt |
1285106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 3584274 - 3584228
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||| | || ||||||||||||||||||||||| |
|
|
| T |
3584274 |
tggtggtcggggtttgaatctcgtaccttgcatatattatgcattgt |
3584228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 6023379 - 6023333
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||| ||||||| |
|
|
| T |
6023379 |
tggtggtcggggtttgaaccccgaaccttgcatattttaagcattgt |
6023333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 7388030 - 7388076
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
7388030 |
tggtggtcggggtttgaatcccgaaccttacatatattatgcattgt |
7388076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 8084497 - 8084451
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
8084497 |
tggtggccggggttcgaaccccggaccttgcatattttatgcattgt |
8084451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 10026064 - 10026018
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
10026064 |
tggtggtcggggtttgaaccccataccttgcatattttatgcattgt |
10026018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 12167477 - 12167431
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| || ||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
12167477 |
tggtggttggggtttgaatcccggaccttgaatatattatgcattgt |
12167431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 20763224 - 20763178
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
20763224 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
20763178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 23221462 - 23221416
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
23221462 |
tggtggttggagtttgaaccacgaaccttacatatattatgcattgt |
23221416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 23413037 - 23413083
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| | |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
23413037 |
tggtggcccgagtttgaactcccgaccttgcatatattatgcattgt |
23413083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 424
Target Start/End: Original strand, 24483889 - 24483931
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgca |
424 |
Q |
| |
|
||||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
24483889 |
tggtggttggagtttgaaccccgaactttgcatatattatgca |
24483931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 28736624 - 28736670
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| || ||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
28736624 |
tggtggttggggtttgaacctcggaccttgcatatatcatgcattgt |
28736670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 29488790 - 29488744
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
29488790 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
29488744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 31292760 - 31292806
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||| ||||||| |||||||||| ||||||||||||| |
|
|
| T |
31292760 |
tggtggccggagttcgaaccccagaccttgcatgtattatgcattgt |
31292806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 33232388 - 33232434
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
33232388 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
33232434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 33610916 - 33610962
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
33610916 |
tggtggccggtgttcgaactccggaccttgcatatattatgcattgt |
33610962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 34284530 - 34284576
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
34284530 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
34284576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 426
Target Start/End: Original strand, 37495907 - 37495953
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37495907 |
gttggtggtcgggatttgaaccttggaccttgcatatattatgcatt |
37495953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 41029342 - 41029296
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||| |||||| |
|
|
| T |
41029342 |
tggtggtcgggattcgaaccccggaccttgcatatattatacattgt |
41029296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 390 - 428
Target Start/End: Original strand, 48103673 - 48103711
Alignment:
| Q |
390 |
ggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
48103673 |
ggagtttgaaccccgaaccttgcatattttatgcattgt |
48103711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 391 - 428
Target Start/End: Original strand, 11908978 - 11909015
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| |
|
|
| T |
11908978 |
gagtttgaacaccagaccttgcatatattatgcattgt |
11909015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 389 - 426
Target Start/End: Complemental strand, 26009339 - 26009302
Alignment:
| Q |
389 |
cggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26009339 |
cggagttcgaaccccagaccttgcatatattatgcatt |
26009302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 391 - 428
Target Start/End: Complemental strand, 35224179 - 35224142
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
35224179 |
gagtttgaaacccggaccttgcatattttatgcattgt |
35224142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 384 - 425
Target Start/End: Complemental strand, 36121720 - 36121679
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
36121720 |
gtggccggggtttgaaccccggaccttgcatattttatgcat |
36121679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 384 - 425
Target Start/End: Complemental strand, 43139333 - 43139292
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
43139333 |
gtggtcggggtttgaaccccgtaccttgcatattttatgcat |
43139292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 387 - 428
Target Start/End: Complemental strand, 44651670 - 44651629
Alignment:
| Q |
387 |
gtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
44651670 |
gtcggagtttgaacttcgaaccttgcatatattatgcattgt |
44651629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 397 - 425
Target Start/End: Original strand, 394366 - 394394
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
394366 |
gaaccccggaccttgcatatattatgcat |
394394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 422
Target Start/End: Original strand, 7994875 - 7994915
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
7994875 |
tggtggtcggggtttgaaccccagaccttacatatattatg |
7994915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 380 - 428
Target Start/End: Original strand, 8237621 - 8237669
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||| ||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
8237621 |
gttggtggccggggtttgaacctcggactttgtatatattatgcattgt |
8237669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 14046602 - 14046646
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| |||||||||||| | ||||||||||||||||||| |
|
|
| T |
14046602 |
tggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14046646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 14356632 - 14356676
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| |||||||||||| | ||||||||||||||||||| |
|
|
| T |
14356632 |
tggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14356676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 17883958 - 17883914
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
17883958 |
tggtggccggagtttgaacccaagaccttgcatatattatacatt |
17883914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 18684199 - 18684156
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||| |||||||||| |
|
|
| T |
18684199 |
tggtggtcggggtttgaaccc-ggaccttgcatacattatgcatt |
18684156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 21105673 - 21105629
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||| ||||| || ||||||||||||||||||||| |
|
|
| T |
21105673 |
tggtggtcggggttcgaacctcgaaccttgcatatattatgcatt |
21105629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 21322245 - 21322201
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| |||||||||| |||||||||||| |||||||||| |
|
|
| T |
21322245 |
tggtggccggggtttgaaccctggaccttgcatacattatgcatt |
21322201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 21554925 - 21554969
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||||||| || ||||||||||||||||| ||||| |
|
|
| T |
21554925 |
tggtggtcggggtttgaatcctggaccttgcatatattaagcatt |
21554969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 393 - 421
Target Start/End: Complemental strand, 23147349 - 23147321
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23147349 |
gtttgaaccccggaccttgcatatattat |
23147321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 25602985 - 25602941
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| || |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
25602985 |
gtggttggggtttcaaccccgggccttgcatatattatgcattgt |
25602941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 34448603 - 34448647
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| | |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
34448603 |
gtggtcagggtttgaaccctggaccttacatatattatgcattgt |
34448647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 394 - 426
Target Start/End: Original strand, 37230031 - 37230063
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
37230031 |
tttgaaccccagaccttgcatatattatgcatt |
37230063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 71)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 27903183 - 27903137
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27903183 |
tggtggtcggagtttgaaccccgaaccttgcatatattatgcattgt |
27903137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 380 - 428
Target Start/End: Original strand, 32200436 - 32200484
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
32200436 |
gttggtggtcggggcttgaaccccggaccttgcatatattatgcattgt |
32200484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 8544980 - 8545026
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
8544980 |
tggtggtcggagttcgaactccggaccttgcatatattatgcattgt |
8545026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 13796400 - 13796354
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
13796400 |
tggtggtcggagtttgtaccccagaccttgcatatattatgcattgt |
13796354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 13864414 - 13864368
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13864414 |
tggtggtcggggtttgaaccccggaccttgcatatattatgtattgt |
13864368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 22522792 - 22522838
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22522792 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
22522838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 35493964 - 35494010
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
35493964 |
tggtggtcggagtttgaatcccgaaccttgcatatattatgcattgt |
35494010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 40715940 - 40715986
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40715940 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
40715986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 33928710 - 33928663
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| | |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33928710 |
ttggtggccagagtttaaaccccggaccttgcatatattatgcattgt |
33928663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 42473953 - 42473918
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473953 |
gtttgaaccccggaccttgcatatattatgcattgt |
42473918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 1538799 - 1538845
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
1538799 |
tggtggtcggcgtttgaacctcggaccttgcatatattatgcgttgt |
1538845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 2839866 - 2839824
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2839866 |
gtggtcggagtttgaaccccgaaccttggatatattatgcatt |
2839824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 6489077 - 6489031
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6489077 |
tggtggccggggtttgaaccccagaccttgcatatattatgcattgt |
6489031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 6624846 - 6624800
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6624846 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
6624800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 15889481 - 15889435
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
15889481 |
tggtggtcggggtttgaaccctagaccttgcatatattatgcattgt |
15889435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 16579365 - 16579411
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| | ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16579365 |
tggtggtcagggtttgaaccacggaccttgcatatattatgcattgt |
16579411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 16701572 - 16701618
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
16701572 |
tggtggtcggggtttgaatcccggaccttgcatatattattcattgt |
16701618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 20125095 - 20125050
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
20125095 |
tggtggtcggagtttgaaccc-gaaccttgcatatattatgcattgt |
20125050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 20688110 - 20688064
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| | |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20688110 |
tggtggccagagtttgaactccggaccttgcatatattatgcattgt |
20688064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 20721120 - 20721074
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20721120 |
tggtagtcggggtttgaaccccggaccttgcatatattatgtattgt |
20721074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 34436921 - 34436875
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34436921 |
tggtgggcggggtttgaaccccggcccttgcatatattatgcattgt |
34436875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 37054260 - 37054306
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
37054260 |
tggtggtcggagtttgaaccccgaaccttatatatattatgcattgt |
37054306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 39963563 - 39963517
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
39963563 |
tggtggtcagagtttgaaccccgaaccttacatatattatgcattgt |
39963517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 42817103 - 42817149
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42817103 |
tggtggtcgaggtttgaaccccggaccttgtatatattatgcattgt |
42817149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 425
Target Start/End: Complemental strand, 24408563 - 24408522
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
24408563 |
gtggtcggggtttgaaccccagaccttgcatatattatgcat |
24408522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 5107236 - 5107280
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||||||||||||| |
|
|
| T |
5107236 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcatt |
5107280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 392 - 428
Target Start/End: Original strand, 10704332 - 10704368
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10704332 |
agtttgaaccccggaccttgcatattttatgcattgt |
10704368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 394 - 426
Target Start/End: Original strand, 21139151 - 21139183
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21139151 |
tttgaaccccggaccttgcatatattatgcatt |
21139183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 34191501 - 34191457
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34191501 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgt |
34191457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 39980578 - 39980534
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| ||||||||| |
|
|
| T |
39980578 |
tggtggtcggggtttgaactccggaccttgcatattttatgcatt |
39980534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 4763188 - 4763223
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4763188 |
gtttgaaccccggaccttacatatattatgcattgt |
4763223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 6424905 - 6424940
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6424905 |
gtttgaaccccggaccttgtatatattatgcattgt |
6424940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Complemental strand, 13409617 - 13409574
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||| |||||||||| |||||||||||||||| |
|
|
| T |
13409617 |
tggtcggggtttgaactccggaccttgtatatattatgcattgt |
13409574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 18589869 - 18589904
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18589869 |
gtttaaaccccggaccttgcatatattatgcattgt |
18589904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 25979903 - 25979868
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25979903 |
gtttgaaccccggaccttgcatacattatgcattgt |
25979868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 421
Target Start/End: Original strand, 25988813 - 25988852
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
25988813 |
tggtggtcggagtttgaatcctggaccttgcatatattat |
25988852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 26409324 - 26409277
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
26409324 |
ttggtgggcggggttcgaaccccggaccttacatatattatgcattgt |
26409277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 30329173 - 30329126
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| | |||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
30329173 |
ttggtggttgaagttcgaaccccggaccttgcgtatattatgcattgt |
30329126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Complemental strand, 30488992 - 30488949
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
30488992 |
tggtcggagtttgaaccccaaaccttgtatatattatgcattgt |
30488949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 32339790 - 32339759
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32339790 |
gaaccccggaccttgcatatattatgcattgt |
32339759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 37932385 - 37932354
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37932385 |
gaaccccggaccttgcatatattatgcattgt |
37932354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 39914971 - 39914925
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| ||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
39914971 |
ttggtggtcggggttcgaaccc-ggaccttgcatatattatgcattgt |
39914925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Original strand, 3445250 - 3445284
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
3445250 |
tttgaaccccggaccttgcatacattatgcattgt |
3445284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 10531610 - 10531564
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||||| ||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
10531610 |
tggtagtcggggtttgaaccacggaccgtgcatatattatgcattgt |
10531564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 11637563 - 11637609
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
11637563 |
tggtggtcggggttcgaaccccgaaccttgcatattttatgcattgt |
11637609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 11720963 - 11720918
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11720963 |
tggtggccggggtttgaaccccg-accttgcatatattatgcattgt |
11720918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 14474904 - 14474858
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||| |||||||||||||||||||| |||| |
|
|
| T |
14474904 |
tggtggccggggtttgaaccctggaccttgcatatattatgcgttgt |
14474858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 424
Target Start/End: Original strand, 17210704 - 17210742
Alignment:
| Q |
386 |
ggtcggagtttgaaccccggaccttgcatatattatgca |
424 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17210704 |
ggtcggagtttgaaccccacaccttgcatatattatgca |
17210742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 17230456 - 17230410
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| ||| | ||| ||||||||||||||||| |
|
|
| T |
17230456 |
tggtggtcggagtttgaactccgaatcttacatatattatgcattgt |
17230410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 18331777 - 18331731
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| | |||||||||||||||||||||| ||||||||||| |
|
|
| T |
18331777 |
tggtggccggggcttgaaccccggaccttgcatattttatgcattgt |
18331731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 18749166 - 18749212
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
18749166 |
tggtggccggagtttaaaccccgggccgtgcatatattatgcattgt |
18749212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 19518591 - 19518637
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| ||||||||||| | |||||||||||||||||||||| |
|
|
| T |
19518591 |
tggtggtcgaggtttgaacccccggccttgcatatattatgcattgt |
19518637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 26655534 - 26655488
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
26655534 |
tggtggccggggttcgaaccccggaccttacatatattatgcattgt |
26655488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 26927119 - 26927073
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
26927119 |
tggtggccggggttcgaaccccggaccttacatatattatgcattgt |
26927073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 29695085 - 29695039
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
29695085 |
tggtggtcggggtttgaaccacgaaccttacatatattatgcattgt |
29695039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 31280089 - 31280043
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
31280089 |
tggtggtcgaggtttgaaccccggatattgcatatattatgcattgt |
31280043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 32234831 - 32234786
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
32234831 |
tggtggtcggggtttgaaccccg-accttgcatattttatgcattgt |
32234786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 34987144 - 34987186
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
34987144 |
gtggtcggaatttgaaccccgaaccttggatatattatgcatt |
34987186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 37462181 - 37462135
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
37462181 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
37462135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 37791154 - 37791200
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||| || |||||||||||||||||| |||| |
|
|
| T |
37791154 |
tggtggccggagtttgaacctcgaaccttgcatatattatgcgttgt |
37791200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 412
Target Start/End: Complemental strand, 40810641 - 40810611
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgc |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40810641 |
tggtggtcggagtttgaaccccggaccttgc |
40810611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 41650931 - 41650976
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
41650931 |
tggtggtcggtgtttgaactc-ggaccttgcatatattatgcattgt |
41650976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 428
Target Start/End: Original strand, 42613199 - 42613241
Alignment:
| Q |
386 |
ggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||| |||||||||||| ||||||||||| |
|
|
| T |
42613199 |
ggtcggaatttgaaccccagaccttgcatattttatgcattgt |
42613241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 387 - 428
Target Start/End: Complemental strand, 776745 - 776704
Alignment:
| Q |
387 |
gtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
776745 |
gtcggagtttgaacctcagaccttgcatattttatgcattgt |
776704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 393 - 426
Target Start/End: Original strand, 12670076 - 12670109
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
12670076 |
gtttgaaccccgaaccttgcatatattatgcatt |
12670109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 391 - 428
Target Start/End: Original strand, 25607058 - 25607095
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
25607058 |
gagttcgaaccccagaccttgcatatattatgcattgt |
25607095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 384 - 421
Target Start/End: Original strand, 40837896 - 40837933
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
40837896 |
gtggtcggggtttgaaccccggaccttgcatattttat |
40837933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 380 - 428
Target Start/End: Complemental strand, 5015352 - 5015304
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| || |||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
5015352 |
gttggtggttggggtttgaactccgaaccttgcatatattattcattgt |
5015304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 17090936 - 17090892
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
17090936 |
tggtggccggggtttgaaccccggaccttgcattaattatgcatt |
17090892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 394 - 426
Target Start/End: Complemental strand, 27679556 - 27679524
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
27679556 |
tttgaaccccgaaccttgcatatattatgcatt |
27679524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 37021363 - 37021407
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| |||||||||| | | ||||||||||||||||||| |
|
|
| T |
37021363 |
tggtggtcggggtttgaaccctgaatcttgcatatattatgcatt |
37021407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 108)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 11949754 - 11949800
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11949754 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
11949800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 19479468 - 19479514
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
19479514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 42845095 - 42845049
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42845095 |
tggtggtcggagttttaaccccggaccttgcatatattatgcattgt |
42845049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 389 - 428
Target Start/End: Original strand, 25783447 - 25783486
Alignment:
| Q |
389 |
cggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25783447 |
cggagtttgaaccccggaccttgcatatattatgcattgt |
25783486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 836226 - 836272
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
836226 |
tggtggtcggagtttgaacctcggaccttgcatatattttgcattgt |
836272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 9946497 - 9946451
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9946497 |
tggtggtcggggtttgaaccccggaccttgcatattttatgcattgt |
9946451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 390 - 428
Target Start/End: Original strand, 17423176 - 17423214
Alignment:
| Q |
390 |
ggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17423176 |
ggagtttgaaccccggaccttgcatatattatgcattgt |
17423214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 19997355 - 19997401
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
19997355 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcattgt |
19997401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 21114296 - 21114342
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21114296 |
tggtggtcggggtttgaaccccggaccttgcatatatcatgcattgt |
21114342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 47015559 - 47015605
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
47015559 |
tggtggtcggagtttgaaccccagaccttgtatatattatgcattgt |
47015605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 49041972 - 49042018
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49041972 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
49042018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 55061107 - 55061061
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
55061107 |
tggtggtcggaatttgaacccccgaccttgcatatattatgcattgt |
55061061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 380 - 428
Target Start/End: Original strand, 22164258 - 22164306
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
22164258 |
gttggtggtcggggtttgaaccccagaccttacatatattatgcattgt |
22164306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 24664982 - 24665026
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
24664982 |
tggtggtcggggttcgaaccccggaccttgcatatattatgcatt |
24665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 426
Target Start/End: Complemental strand, 36035900 - 36035860
Alignment:
| Q |
386 |
ggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36035900 |
ggtcggagtttgaaccccggaccttggatatattatgcatt |
36035860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 48226760 - 48226716
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48226760 |
gtggccggagtttgaaccccggaccttgcatattttatgcattgt |
48226716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 392 - 428
Target Start/End: Original strand, 49953404 - 49953440
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49953404 |
agtttgaaccccggaccttgcatatattatgcattgt |
49953440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 675977 - 675942
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
675977 |
gtttgaaccccggaccttgcatatattatgcattgt |
675942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 7230339 - 7230304
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7230339 |
gtttgaaccccggaccttgcatatattatgcattgt |
7230304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 20383547 - 20383512
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20383547 |
gtttgaaccccggaccttgcatatattatgcattgt |
20383512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 20799396 - 20799431
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20799396 |
gtttgaaccccggaccttgcatatattatgcattgt |
20799431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 29701159 - 29701112
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
29701159 |
ttggtggccggagtttgaaccccggaacttgcatatattatacattgt |
29701112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 41521025 - 41520978
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
41521025 |
ttggtggtcggagtttgaaccttgaaccttgcatatattatgcattgt |
41520978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 3936697 - 3936651
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3936697 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
3936651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 11085756 - 11085802
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
11085756 |
tggtggtcggagtttgaatctcgaaccttgcatatattatgcattgt |
11085802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 11198398 - 11198352
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11198398 |
tggtggccggggtttgaaccccggaccttgcatatattatgccttgt |
11198352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 14202472 - 14202514
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
14202472 |
gtggtcggggtttgaaccccggaccttacatatattatgcatt |
14202514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 424
Target Start/End: Complemental strand, 17729496 - 17729454
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgca |
424 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
17729496 |
tggtggtcggggtttgaaccccagaccttgcatatattatgca |
17729454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 19908762 - 19908716
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
19908762 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcattgt |
19908716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 21318244 - 21318290
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
21318244 |
tggtggtcggggtttgaaccctagaccttgcatatattatgcattgt |
21318290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 22630351 - 22630397
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
22630351 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgt |
22630397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 24079831 - 24079877
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
24079831 |
tggtggtcggggtttgaactccggaccttgcatattttatgcattgt |
24079877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 31041707 - 31041753
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| |||||| |
|
|
| T |
31041707 |
tggtggtcggagttcgaaccccggacattgcatatattatacattgt |
31041753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 32268151 - 32268105
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
32268151 |
tggtggtcggagtttgaaccccaaacctttcatatattatgcattgt |
32268105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 37930838 - 37930884
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
37930838 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgt |
37930884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 54500639 - 54500593
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54500639 |
tggtggtcagtgtttgaaccccggaccttacatatattatgcattgt |
54500593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 54857606 - 54857652
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54857606 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
54857652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 56551583 - 56551629
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
56551583 |
tggtggccggggtttgaacctcggaccttgcatatattatgcattgt |
56551629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 382 - 427
Target Start/End: Complemental strand, 34042310 - 34042265
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattg |
427 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
34042310 |
tggtggtcgaggtttgaaccccgaaccttgcatatattatgcattg |
34042265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 391 - 428
Target Start/End: Complemental strand, 37193310 - 37193273
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37193310 |
gagtttgaaccccggaccttgcatatattatacattgt |
37193273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 393 - 426
Target Start/End: Complemental strand, 44816000 - 44815967
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44816000 |
gtttgaaccccggaccttgcatatattatgcatt |
44815967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 393 - 426
Target Start/End: Original strand, 54294424 - 54294457
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54294424 |
gtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 8027388 - 8027432
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||||||||||| || ||||||||||||||||||| |
|
|
| T |
8027388 |
tggtggtcggggtttgaacccccgatcttgcatatattatgcatt |
8027432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 30847975 - 30848019
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
30847975 |
gtggttggagtttgaacctcggaccttgcatattttatgcattgt |
30848019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 422
Target Start/End: Original strand, 39595928 - 39595968
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
39595928 |
tggtggtcggagtttgaacctcagaccttgcatatattatg |
39595968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 392 - 428
Target Start/End: Original strand, 49952570 - 49952606
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49952570 |
agtttgaaccccggaccttacatatattatgcattgt |
49952606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 281650 - 281615
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
281650 |
gtttgaaccccggacctttcatatattatgcattgt |
281615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 12322732 - 12322697
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12322732 |
gtttgaaccccggaacttgcatatattatgcattgt |
12322697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 16304100 - 16304135
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16304100 |
gtttgaatcccggaccttgcatatattatgcattgt |
16304135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 21317340 - 21317375
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21317340 |
gtttgaacccctgaccttgcatatattatgcattgt |
21317375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 22040709 - 22040674
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22040709 |
gtttgaaccccgaaccttgcatatattatgcattgt |
22040674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 28435250 - 28435285
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28435250 |
gtttgaaccccgaaccttgcatatattatgcattgt |
28435285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 29908115 - 29908080
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29908115 |
gtttgaactccggaccttgcatatattatgcattgt |
29908080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Original strand, 34834012 - 34834043
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34834012 |
gaaccccggaccttgcatatattatgcattgt |
34834043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 421
Target Start/End: Original strand, 34969384 - 34969423
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
34969384 |
tggtggtcggagtttgaaccctgaaccttgcatatattat |
34969423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 37921805 - 37921770
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37921805 |
gtttgaatcccggaccttgcatatattatgcattgt |
37921770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Original strand, 40070962 - 40071005
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
40070962 |
tggtcggggtttgaacttcggaccttgcatatattatgcattgt |
40071005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 428
Target Start/End: Original strand, 40901135 - 40901174
Alignment:
| Q |
389 |
cggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
40901135 |
cggagtttgaactcccgaccttgcatatattatgcattgt |
40901174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 43722824 - 43722789
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43722824 |
gtttgaaccccggaccttacatatattatgcattgt |
43722789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 428
Target Start/End: Original strand, 43782295 - 43782342
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
43782295 |
ttggtggtcgaggtttgaaccgcagaccttgcatatattatgcattgt |
43782342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Original strand, 46676504 - 46676535
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46676504 |
gaaccccggaccttgcatatattatgcattgt |
46676535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 49473700 - 49473669
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49473700 |
gaaccccggaccttgcatatattatgcattgt |
49473669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 50362141 - 50362176
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50362141 |
gtttgaaccctggaccttgcatatattatgcattgt |
50362176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 5924719 - 5924673
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
5924719 |
tggtggtcgaggtttgaaccccggaccttccatatattatgtattgt |
5924673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 6610331 - 6610289
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6610331 |
gtggtcggggtttgaaccccagaccttgcatatattatacatt |
6610289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 10261760 - 10261806
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
10261760 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
10261806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 16067912 - 16067958
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||||| ||||| |
|
|
| T |
16067912 |
tggtggtcggagttcgaacctcggaccttgcatattttatgtattgt |
16067958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 16470374 - 16470328
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
16470374 |
tggtggtcggggttcgaaccctggaccttgcatattttatgcattgt |
16470328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Complemental strand, 16737129 - 16737095
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
16737129 |
tttgaacccccgaccttgcatatattatgcattgt |
16737095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 19588224 - 19588178
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
19588224 |
tggtggccggggtttgaaccctggaccttgcatattttatgcattgt |
19588178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 21562695 - 21562649
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
21562695 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
21562649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 23160110 - 23160064
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| || ||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
23160110 |
tggtgttcagagtttgaacctcggaccttacatatattatgcattgt |
23160064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 23775588 - 23775542
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| || ||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
23775588 |
tggtggttggggttcgaaccctggaccttgcatatattatgcattgt |
23775542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 26926701 - 26926747
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
26926701 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
26926747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 31760316 - 31760270
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
31760316 |
tggtggttggagtttgaactctggaccttgcatatattatacattgt |
31760270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 35287498 - 35287544
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
35287498 |
tggtggccggggttggaaccccggaccttgcatattttatgcattgt |
35287544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 36490638 - 36490592
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
36490638 |
tggtggtcgggatttgaaccccggatcttgcatacattatgcattgt |
36490592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 422
Target Start/End: Original strand, 37081227 - 37081265
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
37081227 |
gtggtcggagtttgaacctcggaccttggatatattatg |
37081265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 38375027 - 38374981
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| || |||||||||||||||||||||||| |
|
|
| T |
38375027 |
tggtggccggggtttgaactccagaccttgcatatattatgcattgt |
38374981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 42344609 - 42344655
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
42344609 |
tggtggtcgatgtttgaacctcggaccttgcatatattatacattgt |
42344655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 43034333 - 43034379
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
43034333 |
tggtggccggggtttgaacctcagaccttgcatatattatgcattgt |
43034379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 43330216 - 43330170
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
43330216 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
43330170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 45343803 - 45343849
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||||||||| |||||| |
|
|
| T |
45343803 |
tggtggttggagttcgaaccccggaccttacatatattatacattgt |
45343849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 47806247 - 47806293
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| |||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
47806247 |
tggtgttcggggttcgaaccccagaccttgcatatattatgcattgt |
47806293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 422
Target Start/End: Original strand, 47814244 - 47814282
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
47814244 |
gtggccggggtttgaaccccggaccttgcatatattatg |
47814282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 51450282 - 51450236
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
51450282 |
tggtggccggggtttgaactccggaccttgcatatcttatgcattgt |
51450236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 393 - 426
Target Start/End: Complemental strand, 6087806 - 6087773
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
6087806 |
gtttgaaccccagaccttgcatatattatgcatt |
6087773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 391 - 428
Target Start/End: Complemental strand, 22411825 - 22411788
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
22411825 |
gagtttgaaccccgaaccttacatatattatgcattgt |
22411788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 27740809 - 27740764
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| ||||||||||| |
|
|
| T |
27740809 |
ggtggtcggagttcgaactccgaaccttgcatattttatgcattgt |
27740764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 386 - 427
Target Start/End: Original strand, 30850379 - 30850420
Alignment:
| Q |
386 |
ggtcggagtttgaaccccggaccttgcatatattatgcattg |
427 |
Q |
| |
|
|||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
30850379 |
ggtcggggtttgaaccctgaaccttgcatatattatgcattg |
30850420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 382 - 423
Target Start/End: Complemental strand, 40160922 - 40160881
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgc |
423 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
40160922 |
tggtggtcggagtttgaactccaaaccttgcatatattatgc |
40160881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 42139913 - 42139868
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| ||| ||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
42139913 |
ggtggccggggtttgaaccccggacattgcatgtattatgcattgt |
42139868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 2888944 - 2888900
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
2888944 |
tggtggccggggtttgaaccgcggaccttgcatatattatacatt |
2888900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 428
Target Start/End: Original strand, 3346271 - 3346311
Alignment:
| Q |
388 |
tcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
3346271 |
tcggagtttgacactcggaccttgcatatattatgcattgt |
3346311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 380 - 428
Target Start/End: Original strand, 7371537 - 7371585
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||| ||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
7371537 |
gttggtgtccggggttcgaaccccggaccttgcatatattatgtattgt |
7371585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 422
Target Start/End: Complemental strand, 10035335 - 10035295
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10035335 |
tggtggccggggtttgaaccccagaccttgcatatattatg |
10035295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 428
Target Start/End: Complemental strand, 11692715 - 11692675
Alignment:
| Q |
389 |
cggagtttgaaccccg-gaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11692715 |
cggagtttgaacccccagaccttgcatatattatgcattgt |
11692675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 13276197 - 13276153
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| |||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
13276197 |
gtgggcggaatttgaaacacggaccttgcatatattatgcattgt |
13276153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 18004535 - 18004491
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
18004535 |
tggtggtcggagtttgaacgtcggatcttacatatattatgcatt |
18004491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 393 - 425
Target Start/End: Complemental strand, 18094464 - 18094432
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
18094464 |
gtttgaaccctggaccttgcatatattatgcat |
18094432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 18903749 - 18903793
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| | ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
18903749 |
tggtggtcagggtttgaaccccagaccttacatatattatgcatt |
18903793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 392 - 428
Target Start/End: Original strand, 27871379 - 27871415
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
27871379 |
agtttgaacctcggaccttgcatatattatacattgt |
27871415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 32006570 - 32006526
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| |||||||||||||||| || || ||||||||||||||| |
|
|
| T |
32006570 |
tggtggccggagtttgaaccccgaactttacatatattatgcatt |
32006526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 380 - 428
Target Start/End: Complemental strand, 37800903 - 37800855
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||| ||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
37800903 |
gttggtgatcggggttcgaaccccagacctcgcatatattatgcattgt |
37800855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 43374265 - 43374309
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
43374265 |
gtggtcggggtttgaactccgaaccttgcatattttatgcattgt |
43374309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 49491258 - 49491214
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||| |||||| || |||||||||| |||| |
|
|
| T |
49491258 |
tggtggtcggagtttgaactccggactttacatatattatacatt |
49491214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 393 - 425
Target Start/End: Original strand, 50152240 - 50152272
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
50152240 |
gtttgaaccccgaaccttgcatatattatgcat |
50152272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 386 - 426
Target Start/End: Original strand, 52869004 - 52869044
Alignment:
| Q |
386 |
ggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| |||||||| |||||||||| |||||||||||||| |
|
|
| T |
52869004 |
ggtcggggtttgaactccggaccttgtatatattatgcatt |
52869044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 83)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 31815878 - 31815924
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31815878 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
31815924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 381 - 428
Target Start/End: Original strand, 660812 - 660859
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
660812 |
ttggtggtcggggtttgaaccctggaccttgcatatattatgcattgt |
660859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 20565066 - 20565112
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20565066 |
tggtggttggggtttgaaccccggaccttgcatatattatgcattgt |
20565112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 23250311 - 23250357
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23250311 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcattgt |
23250357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 29544697 - 29544651
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29544697 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
29544651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 29600007 - 29599965
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29600007 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
29599965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 428
Target Start/End: Complemental strand, 32458367 - 32458326
Alignment:
| Q |
387 |
gtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32458367 |
gtcggagtttgaaccctggaccttgcatatattatgcattgt |
32458326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 8091151 - 8091195
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8091151 |
gtggtcgatgtttgaaccccggaccttgcatatattatgcattgt |
8091195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 8781643 - 8781687
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8781643 |
gtggtcggggtttgaaccccggaccttgcatacattatgcattgt |
8781687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 27848228 - 27848184
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27848228 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 31543082 - 31543038
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
31543082 |
tggtggttggggtttgaaccccggaccttgcatatattatgcatt |
31543038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 42791363 - 42791319
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42791363 |
gtggccggggtttgaaccccggaccttgcatatattatgcattgt |
42791319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 382 - 425
Target Start/End: Original strand, 10735822 - 10735865
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10735822 |
tggtggccggggtttgaaccccggaccttgcatatattatgcat |
10735865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 382 - 421
Target Start/End: Complemental strand, 18290722 - 18290683
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18290722 |
tggtggtcggagtttgaaccccgaaccttgcatatattat |
18290683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 25186244 - 25186279
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25186244 |
gtttgaaccccggaccttgcatatattatgcattgt |
25186279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 428
Target Start/End: Complemental strand, 29734758 - 29734715
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29734758 |
tggtcggggtttgaaccacggaccttgcatatattatgcattgt |
29734715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 36359373 - 36359338
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36359373 |
gtttgaaccccggaccttgcatatattatgcattgt |
36359338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 4180765 - 4180723
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
4180765 |
gtggtcggggtttgaaccccggaccttgcatattttatgcatt |
4180723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 4238829 - 4238783
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
4238829 |
tggtggtcggagttcgaaccccgaaccttacatatattatgcattgt |
4238783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 9547400 - 9547446
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9547400 |
tggtggtcggggtttgaaccccaaaccttgcatatattatgcattgt |
9547446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 11175855 - 11175809
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
11175855 |
tggtggccggagtttgaaccccagatcttgcatatattatgcattgt |
11175809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 13100257 - 13100299
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13100257 |
gtggtcggagtttgaacctcggaccttggatatattatgcatt |
13100299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 428
Target Start/End: Complemental strand, 19160007 - 19159965
Alignment:
| Q |
386 |
ggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
19160007 |
ggtcggagtttgaactccgaaccttgcatatattatgcattgt |
19159965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 20200775 - 20200729
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20200775 |
tggtggccggggtttgaaccctggaccttgcatatattatgcattgt |
20200729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 23407009 - 23407055
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23407009 |
tggtggtcagggtttgaaccccagaccttgcatatattatgcattgt |
23407055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 24579659 - 24579705
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| | |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24579659 |
tggtggccagagtttgaaccctggaccttgcatatattatgcattgt |
24579705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 24581008 - 24581054
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
24581008 |
tggtggtcggggtttgaacctcgaaccttgcatatattatgcattgt |
24581054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 24592837 - 24592883
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24592837 |
tggtggccggggtttgaaccccagaccttgcatatattatgcattgt |
24592883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 25612284 - 25612330
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
25612284 |
tggtggtcgggggttgaatcccggaccttgcatatattatgcattgt |
25612330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 26999180 - 26999134
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
26999180 |
tggtggccggagtttgaaccgcagaccttgcatatattatgcattgt |
26999134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 29896285 - 29896331
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29896285 |
tggtggtcggggtttgaaccccaaaccttgcatatattatgcattgt |
29896331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 33064056 - 33064010
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
33064056 |
tggtggccggagttcgaactccggaccttgcatatattatgcattgt |
33064010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 36474832 - 36474786
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36474832 |
tggtggccggaatttgaaccccggaccttgcatattttatgcattgt |
36474786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 425
Target Start/End: Original strand, 40853811 - 40853852
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
40853811 |
gtggtcggggtttgatccccggaccttgcatatattatgcat |
40853852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 5168570 - 5168614
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||| ||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
5168570 |
tggtagtcggggtttgaaccccgaaccttgcatatattatgcatt |
5168614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 18693655 - 18693699
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
18693655 |
gtggtcggggtttgaaccctggatcttgcatatattatgcattgt |
18693699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 22709153 - 22709109
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgt |
22709109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 33890169 - 33890213
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||| |||| |
|
|
| T |
33890169 |
gtggtcggagtttgaacgccggaccttacatatattatgcgttgt |
33890213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 36264470 - 36264514
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
36264470 |
tggtggtcggggtttgaaccccgaactttgcatatattatgcatt |
36264514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 42347736 - 42347692
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
42347736 |
gtggtcggagtttgaacactggaccttgcatattttatgcattgt |
42347692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 3617163 - 3617116
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||||| |||| |||| ||||||||||||||| |
|
|
| T |
3617163 |
ttggtggccggagtttgaaccctggactttgcgtatattatgcattgt |
3617116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 12124600 - 12124569
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12124600 |
gaaccccggaccttgcatatattatgcattgt |
12124569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 20455946 - 20455915
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20455946 |
gaaccccggaccttgcatatattatgcattgt |
20455915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 24593431 - 24593400
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24593431 |
gaaccccggaccttgcatatattatgcattgt |
24593400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 30089108 - 30089073
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30089108 |
gtttgaaccccggaccttgtatatattatgcattgt |
30089073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 30125712 - 30125677
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30125712 |
gtttgaaccccggaccttgtatatattatgcattgt |
30125677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 35820303 - 35820338
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35820303 |
gtttgaaccccggaccttgcatgtattatgcattgt |
35820338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 43043167 - 43043202
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43043167 |
gtttgaaccccggaccttgcatacattatgcattgt |
43043202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 44526199 - 44526152
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||| ||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
44526199 |
ttggtggccggggtttgaatcccggaccttgcgtatattatgcattgt |
44526152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 346117 - 346159
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
346117 |
gtggtcggggtttgaaccctggaccttacatatattatgcatt |
346159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 2257041 - 2256995
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
2257041 |
tggtggccggggttcgaaccccagaccttgcatatattatgcattgt |
2256995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 3708763 - 3708717
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
3708763 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
3708717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 4138061 - 4138015
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
4138061 |
tggtggtcggggtttgaatctcggaccttgcatatattatacattgt |
4138015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 4557762 - 4557808
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| | ||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
4557762 |
tggtggtcagggtttgaaccacggaccttacatatattatgcattgt |
4557808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 9429285 - 9429239
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||| |||||| |
|
|
| T |
9429285 |
tggtggtcggagtttgaactccggaatttgcatatattatacattgt |
9429239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 11868653 - 11868699
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
11868653 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
11868699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 12599856 - 12599902
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
12599856 |
tggtggtcggggttcgaaccccagaccttgcatatattatgtattgt |
12599902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Original strand, 20120724 - 20120758
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20120724 |
tttgaaccccgaaccttgcatatattatgcattgt |
20120758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 20990895 - 20990941
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
20990895 |
tggtggtcggggtttgaaccctgaaccttgcatattttatgcattgt |
20990941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Original strand, 22571868 - 22571902
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
22571868 |
tttgaaccccggacattgcatatattatgcattgt |
22571902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 23719005 - 23718959
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||| |||| |
|
|
| T |
23719005 |
tggtggtcggagtttgaacaccagaccttgcatattttatgcgttgt |
23718959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 24106677 - 24106631
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| |||||| |||| |
|
|
| T |
24106677 |
tggtggtcggagtttgaacaccagaccttgcatattttatgcgttgt |
24106631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 424
Target Start/End: Original strand, 25561988 - 25562030
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgca |
424 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||| ||||||| |
|
|
| T |
25561988 |
tggtggtcggagtttgaaccccagatcttgcatattttatgca |
25562030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 25625786 - 25625740
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
25625786 |
tggtggtccgggtttgaaccccggaccttacatatattatgaattgt |
25625740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 424
Target Start/End: Complemental strand, 27411162 - 27411120
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgca |
424 |
Q |
| |
|
|||||| ||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
27411162 |
tggtggccggggttcgaaccccggaccttgcatatattatgca |
27411120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 34977274 - 34977228
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
34977274 |
tggtggccggggtttaaactccggaccttgcatatattatgcattgt |
34977228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 35287655 - 35287701
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| | |||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
35287655 |
tggtggccagagtttaaaccccggaccttgcatctattatgcattgt |
35287701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 35360046 - 35360092
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
35360046 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
35360092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 39688326 - 39688280
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||| |||| |||||| |
|
|
| T |
39688326 |
tggtggtcggagtttgaaccccagatcttgcatattttattcattgt |
39688280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 40994768 - 40994814
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
40994768 |
tggtggtcggtgtttgaaccccgaaccttgcatctattatgtattgt |
40994814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 41859922 - 41859876
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgt |
41859876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 393 - 427
Target Start/End: Complemental strand, 44810764 - 44810730
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattg |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
44810764 |
gtttgaaccccggaccttgcatatattatgtattg |
44810730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 395 - 428
Target Start/End: Complemental strand, 7537167 - 7537134
Alignment:
| Q |
395 |
ttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
7537167 |
ttgaactccggaccttgcatatattatgcattgt |
7537134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 381 - 426
Target Start/End: Complemental strand, 16082204 - 16082159
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
16082204 |
ttggtggtcggaggttgaactttggaccttgcatatattatgcatt |
16082159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 393 - 426
Target Start/End: Complemental strand, 30978421 - 30978388
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
30978421 |
gtttgaacccctgaccttgcatatattatgcatt |
30978388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 10724009 - 10723965
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
10724009 |
tggtggccggggtttgaacctcagaccttgcatatattatgcatt |
10723965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 11551236 - 11551192
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| |||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
11551236 |
gtggccggagtttgaaccccgaatcttgcatattttatgcattgt |
11551192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 20644074 - 20644030
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
20644074 |
tggtggtcggagtttgaacgtcggatcttacatatattatgcatt |
20644030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 21482510 - 21482554
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
21482510 |
tggtggtcggggttcaaaccccggaccttgcatatattatacatt |
21482554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 392 - 428
Target Start/End: Original strand, 23468045 - 23468081
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23468045 |
agtttgaacccccaaccttgcatatattatgcattgt |
23468081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 28439560 - 28439604
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
28439560 |
tggtggtcggagtttgaacatcagaccttgcatattttatgcatt |
28439604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 393 - 425
Target Start/End: Complemental strand, 37852069 - 37852037
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
37852069 |
gtttgaaccctggaccttgcatatattatgcat |
37852037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 41356220 - 41356176
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
41356220 |
gtggtcggggtttgaaccccgaaccttgtatattttatgcattgt |
41356176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 95)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 12268977 - 12269021
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12268977 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
12269021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 381 - 428
Target Start/End: Original strand, 2596930 - 2596977
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2596930 |
ttggaggtcggagtttgaaccccggaccttgcatattttatgcattgt |
2596977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 8269359 - 8269405
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8269359 |
tggtggtcggggtttgaaccccggaccttgcatatattatgtattgt |
8269405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 16033441 - 16033487
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16033441 |
tggtggccggagtttgaaccccagaccttgcatatattatgcattgt |
16033487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 17139508 - 17139554
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17139508 |
tggtggtcggggtttgaaccccggaccttgaatatattatgcattgt |
17139554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 24571616 - 24571662
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
24571616 |
tggtggtcggagtttgaaccccagaccttgcatatattatgtattgt |
24571662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 27533313 - 27533267
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27533313 |
tggtggtcggggtttgaaccccgaaccttgcatatattatgcattgt |
27533267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 39252137 - 39252183
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39252137 |
tggtggttggagtttgaaccccggaccttgcatatattatgtattgt |
39252183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 41769808 - 41769850
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41769808 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
41769850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 2994826 - 2994782
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2994826 |
gtggtcggggtttgaaccccggaccttgcatatattatacattgt |
2994782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 18166670 - 18166626
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18166670 |
gtggtcggggtttgaaccccggactttgcatatattatgcattgt |
18166626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 46392303 - 46392259
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
46392303 |
tggtggtcggaatttgaaccccggaccttggatatattatgcatt |
46392259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 383 - 426
Target Start/End: Complemental strand, 12212364 - 12212321
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
12212364 |
ggtggtcggggtttgaaccccggacgttgcatatattatgcatt |
12212321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 25533032 - 25532997
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25533032 |
gtttgaaccccggaccttgcatatattatgcattgt |
25532997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 34521192 - 34521227
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34521192 |
gtttgaaccccggaccttgcatatattatgcattgt |
34521227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 389 - 428
Target Start/End: Complemental strand, 45481556 - 45481517
Alignment:
| Q |
389 |
cggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45481556 |
cggagttcgaaccccggaccttgcatatattatgcattgt |
45481517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 48646716 - 48646763
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcata-tattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48646716 |
tggtggccggagtttgaaccccggaccttgcatattattatgcattgt |
48646763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 1091249 - 1091203
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
1091249 |
tggtggtcagagtttgaaccccgaaccttgcatacattatgcattgt |
1091203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 1794666 - 1794620
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1794666 |
tggtggtcgaggtttgaaccccggatcttgcatatattatgcattgt |
1794620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 8736505 - 8736459
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8736505 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
8736459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 10356174 - 10356220
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
10356174 |
tggtggccggagttcgaaccccggaccgtgcatatattatgcattgt |
10356220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 16307719 - 16307673
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16307719 |
tggtggtcggggtttgatccccagaccttgcatatattatgcattgt |
16307673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 16967185 - 16967231
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
16967185 |
tggtggccggagtttgaacctcgaaccttgcatatattatgcattgt |
16967231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 17669715 - 17669669
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
17669715 |
tggtggccggagtttgaaccccgaaccttgcatatattatacattgt |
17669669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 32864362 - 32864316
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
32864362 |
tggtggtcggagctcgaaccccggactttgcatatattatgcattgt |
32864316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 32950752 - 32950798
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32950752 |
tggtggtcgaggtttgaactccggaccttgcatatattatgcattgt |
32950798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 32962633 - 32962587
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32962633 |
tggtggtcggggtttgaaccctggaccttgcatattttatgcattgt |
32962587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 33206799 - 33206841
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
33206799 |
gtggtcggagtttgaaccccagaccttggatatattatgcatt |
33206841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 41973325 - 41973279
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41973325 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
41973279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 48681924 - 48681970
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
48681924 |
tggtggtcggagtttgagctccgaaccttgcatatattatgcattgt |
48681970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 390 - 428
Target Start/End: Complemental strand, 49222878 - 49222840
Alignment:
| Q |
390 |
ggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49222878 |
ggagtttgaaccccggaccttgcatatattgtgcattgt |
49222840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 13401666 - 13401621
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
13401666 |
ggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
13401621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 382 - 427
Target Start/End: Complemental strand, 30521937 - 30521892
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattg |
427 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
30521937 |
tggtggttggaatttgaatcccggaccttgcatatattatgcattg |
30521892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 393 - 426
Target Start/End: Complemental strand, 34595931 - 34595898
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34595931 |
gtttgaaccccggaccttgcatatattatgcatt |
34595898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 391 - 428
Target Start/End: Complemental strand, 36679651 - 36679614
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36679651 |
gagtttgaaccccggaccttgcatatattatccattgt |
36679614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 391 - 428
Target Start/End: Complemental strand, 45003461 - 45003424
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45003461 |
gagtttgaaccccggaccttgcatatattatccattgt |
45003424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 3481631 - 3481587
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
3481631 |
tggtggccggggtttgaaccccagaccttgcatatattatgcatt |
3481587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 396 - 428
Target Start/End: Original strand, 4968620 - 4968652
Alignment:
| Q |
396 |
tgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4968620 |
tgaaccccggaccttgcatatattatgcattgt |
4968652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 10356706 - 10356749
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
10356706 |
tggtggtcgg-gtttgaaccccagaccttgcatatattatgcatt |
10356749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 16966963 - 16967007
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
16966963 |
tggtggccggagtttgaacctcgaaccttgcatatattatgcatt |
16967007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 380 - 428
Target Start/End: Complemental strand, 22335430 - 22335382
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
22335430 |
gttggtgttcggggtttgaacctcagaccttgcatatattatgcattgt |
22335382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 23203390 - 23203346
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23203390 |
gtggtcggggtttgaaccccgaaccttgcatattttatgcattgt |
23203346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 31338089 - 31338045
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
31338089 |
tggtggtcggagtttgaatcccgcaccttgtatatattatgcatt |
31338045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 32561041 - 32560997
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
32561041 |
gtggtcgggatttgaaccccggaccttgcatatattatacattgt |
32560997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 49431984 - 49432028
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
49431984 |
tggtggccggggtttgaaccccggaccttacatatattatgcatt |
49432028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 1605455 - 1605420
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1605455 |
gtttgaaccccggaccttgcatattttatgcattgt |
1605420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 5907858 - 5907823
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5907858 |
gtttgaaccctggaccttgcatatattatgcattgt |
5907823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 6000145 - 6000180
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6000145 |
gtttgaacctcggaccttgcatatattatgcattgt |
6000180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 10654449 - 10654484
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10654449 |
gtttgaaccacggaccttgcatatattatgcattgt |
10654484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 11681282 - 11681247
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11681282 |
gtttgaaccccagaccttgcatatattatgcattgt |
11681247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 15668557 - 15668522
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15668557 |
gtttgaaccccggaccttgcatattttatgcattgt |
15668522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 26755675 - 26755640
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26755675 |
gtttgaaccccggaccttgcatatataatgcattgt |
26755640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 26803453 - 26803488
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26803453 |
gtttgaaccccggactttgcatatattatgcattgt |
26803488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 29739396 - 29739361
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29739396 |
gtttgaaccccggaccttgcatattttatgcattgt |
29739361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Original strand, 38448872 - 38448903
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38448872 |
gaaccccggaccttgcatatattatgcattgt |
38448903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 40613078 - 40613047
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40613078 |
gaaccccggaccttgcatatattatgcattgt |
40613047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 46707931 - 46707896
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46707931 |
gtttgaaccccggaacttgcatatattatgcattgt |
46707896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 391 - 428
Target Start/End: Original strand, 3509940 - 3509978
Alignment:
| Q |
391 |
gagtttgaacccc-ggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3509940 |
gagtttgaacccccggaccttgcatatattatgcattgt |
3509978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 4295302 - 4295260
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
4295302 |
gtggtcggagtttgaaccccataccttggatatattatgcatt |
4295260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 424
Target Start/End: Complemental strand, 5280701 - 5280659
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgca |
424 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
5280701 |
tggtggtcggggttcgaaccccagaccttgcatatattatgca |
5280659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 5503756 - 5503802
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| ||||||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
5503756 |
tggtgatcggagtttgaaccccgaaccttgtatattttatgcattgt |
5503802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 7732490 - 7732448
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||||||||| |
|
|
| T |
7732490 |
gtggtcggagtttgaatcccggatcttggatatattatgcatt |
7732448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 390 - 428
Target Start/End: Original strand, 9616888 - 9616926
Alignment:
| Q |
390 |
ggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
9616888 |
ggagtttgaaccgcggaccttgtatatattatgcattgt |
9616926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Complemental strand, 19620634 - 19620600
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19620634 |
tttgaaccccggaccttgcatatattatgtattgt |
19620600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 420
Target Start/End: Original strand, 19795107 - 19795145
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatatta |
420 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
19795107 |
tggtggccggggtttgaaccccggaccttgcatatatta |
19795145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 23405349 - 23405395
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
23405349 |
tggtggtcgggattcgaaccctggaccttgcatatattatgcattgt |
23405395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 28832162 - 28832208
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
28832162 |
tggtggtcgggatttgaacctcagaccttgcatatattatgcattgt |
28832208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 32923888 - 32923842
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
32923888 |
tggtggtcggagtttgaacttcagacctttcatatattatgcattgt |
32923842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 32944806 - 32944760
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
32944806 |
tggtggtcggggttcgaaccccagacgttgcatatattatgcattgt |
32944760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 33153871 - 33153917
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| |||| ||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
33153871 |
tggtgttcggggtttgaacctcggaccttacatatattatgcattgt |
33153917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 34899617 - 34899663
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
34899617 |
tggtggtcggagtttgaaccccaaactttgcatatattatgtattgt |
34899663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 39252248 - 39252294
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||||||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
39252248 |
tggtggttggagtttgaaccctggaccttacatatattatgtattgt |
39252294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 41763148 - 41763190
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcatattttatgcatt |
41763190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 42045363 - 42045409
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| || |||||||||||||||||||||||| |
|
|
| T |
42045363 |
tggtggccggggtttgaactccagaccttgcatatattatgcattgt |
42045409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Complemental strand, 44641585 - 44641551
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
44641585 |
tttgaaccccgggccttgcatatattatgcattgt |
44641551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Original strand, 44678020 - 44678054
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44678020 |
tttgaaccccgaaccttgcatatattatgcattgt |
44678054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 52262157 - 52262203
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||| || || |||||||| ||||||||||| |
|
|
| T |
52262157 |
tggtggtcggagtttgaacctcgaactttgcatattttatgcattgt |
52262203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 389 - 422
Target Start/End: Complemental strand, 563264 - 563231
Alignment:
| Q |
389 |
cggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
563264 |
cggagtttgaactccggaccttgcatatattatg |
563231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 393 - 422
Target Start/End: Original strand, 3937524 - 3937553
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3937524 |
gtttgaaccccggaccttgcatatattatg |
3937553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 381 - 426
Target Start/End: Original strand, 12852192 - 12852237
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||||| |||||||||| || ||| ||||||||||||||| |
|
|
| T |
12852192 |
ttggtggtcggattttgaaccccagatcttacatatattatgcatt |
12852237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 387 - 428
Target Start/End: Complemental strand, 23045256 - 23045215
Alignment:
| Q |
387 |
gtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23045256 |
gtcgaagtttgaactccggaccttacatatattatgcattgt |
23045215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 383 - 428
Target Start/End: Original strand, 27526748 - 27526792
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| |||||||||| |
|
|
| T |
27526748 |
ggtggtcggagtttgaaccccagatcttgcatata-tatgcattgt |
27526792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 34848545 - 34848500
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
34848545 |
ggtggtcgaagtttgaacctcagaccttgcatatattatgaattgt |
34848500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 385 - 426
Target Start/End: Complemental strand, 37050996 - 37050955
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37050996 |
tggtcggggttcgaaccccggaccttgcatattttatgcatt |
37050955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 51241559 - 51241514
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||| | ||||| | ||||||||||||||||||||||| |
|
|
| T |
51241559 |
ggtggtcggagtctaaaccctgaaccttgcatatattatgcattgt |
51241514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 3431400 - 3431356
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||||||||| || || |||||||||||||||||| |
|
|
| T |
3431400 |
tggtggtcggggtttgaacctcgtacattgcatatattatgcatt |
3431356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 5869834 - 5869790
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| |||||||| ||| | ||||||||||||||||||| |
|
|
| T |
5869834 |
tggtggtcggggtttgaactccgaatcttgcatatattatgcatt |
5869790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 418
Target Start/End: Original strand, 6423752 - 6423788
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatat |
418 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
6423752 |
tggtggccggggtttgaaccccggaccttgcatatat |
6423788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 13778631 - 13778587
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
13778631 |
tggtggtcgaggtttgaaccccgaaccttgcatattttatgcatt |
13778587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 394 - 426
Target Start/End: Complemental strand, 22346734 - 22346702
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
22346734 |
tttgaaccccggaccttgcatattttatgcatt |
22346702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 392 - 428
Target Start/End: Original strand, 23397324 - 23397360
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
23397324 |
agttcgaaccccggaccttgcatatgttatgcattgt |
23397360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 29042607 - 29042563
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
29042607 |
tggtggtcgggatttgaaccccggatcttacatatattatgcatt |
29042563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 425
Target Start/End: Complemental strand, 44068989 - 44068949
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
44068989 |
tggtcggtgttcgaactccggaccttgcatatattatgcat |
44068949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 48131219 - 48131263
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| |||||||||| || |||||| ||||||||||||||| |
|
|
| T |
48131219 |
tggtggtcagagtttgaactccagaccttacatatattatgcatt |
48131263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 392 - 424
Target Start/End: Original strand, 48898493 - 48898525
Alignment:
| Q |
392 |
agtttgaaccccggaccttgcatatattatgca |
424 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
48898493 |
agtttgaaccccgaaccttgcatatattatgca |
48898525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 31913 - 31959
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31913 |
tggtggccggagtgtgaaccccggaccttgcatatattatgcattgt |
31959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 99107 - 99061
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
99107 |
tggttgtcggagtttgaaccccagaccttgcatatattatgcattgt |
99061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 66)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 8569779 - 8569733
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8569779 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
8569733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 15187133 - 15187087
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15187133 |
tggtggtcggggtttgaacctcggaccttgcatatattatgcattgt |
15187087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 15473473 - 15473519
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15473473 |
tggtggtcggggtttgaacctcggaccttgcatatattatgcattgt |
15473519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 28231416 - 28231462
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28231416 |
tggtggccggagtgtgaaccccggaccttgcatatattatgcattgt |
28231462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 20744206 - 20744162
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20744206 |
gtggtcggggtttgaaccccagaccttgcatatattatgcattgt |
20744162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 26356074 - 26356118
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26356074 |
gtggccggagtttgaaccccgaaccttgcatatattatgcattgt |
26356118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 29680658 - 29680614
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29680658 |
tggtggtcggagtttgaacaccgaaccttgcatatattatgcatt |
29680614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 380 - 428
Target Start/End: Complemental strand, 32053860 - 32053812
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
32053860 |
gttggtggccggagtttgaaccacgaaccttgcatatattatgcattgt |
32053812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 34481407 - 34481451
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34481407 |
gtggtcggggtttgaaccccggaccttgcatatataatgcattgt |
34481451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 428
Target Start/End: Complemental strand, 13496183 - 13496140
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13496183 |
tggtcggggtttgaactccggaccttgcatatattatgcattgt |
13496140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 33824940 - 33824905
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33824940 |
gtttgaaccccggaccttgcatatattatgcattgt |
33824905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 788936 - 788890
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
788936 |
tggtggtcggggtttgaactccgaaccttgcatatattatgcattgt |
788890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 4455587 - 4455633
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
4455587 |
tggtggtcggggtttgaaccccagaccttgcatatattatgccttgt |
4455633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 8629687 - 8629733
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8629687 |
tggtggtcgaggtttgaaccccgaaccttgcatatattatgcattgt |
8629733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 394 - 428
Target Start/End: Complemental strand, 12215811 - 12215777
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12215811 |
tttgaaccccggaccttgcatatattatgcattgt |
12215777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 15155805 - 15155759
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15155805 |
tggtggtcgtggtttgaaccccagaccttgcatatattatgcattgt |
15155759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 15170001 - 15169955
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
15170001 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
15169955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 15178773 - 15178727
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
15178773 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
15178727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 16204781 - 16204827
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
16204781 |
tggtggtcgggatttgaaccccggaccttgcatacattatgcattgt |
16204827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 17113451 - 17113497
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
17113451 |
tggtggtcgaagtttgaacctcagaccttgcatatattatgcattgt |
17113497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 23903298 - 23903344
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
23903298 |
tggtggtcggtgtttgaaccccgaacgttgcatatattatgcattgt |
23903344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 24623308 - 24623354
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
24623308 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
24623354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 29283885 - 29283839
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29283885 |
tggtggtcggagtttgaaccctagaccttgcatatattatacattgt |
29283839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 29740552 - 29740506
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29740552 |
tggtggccggggtttgaaccccggaccttgcgtatattatgcattgt |
29740506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 34701217 - 34701171
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
34701217 |
tggtggccggagtttgaacctcagaccttgcatatattatgcattgt |
34701171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 391 - 428
Target Start/End: Original strand, 19265524 - 19265561
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19265524 |
gagtttgaaccccggaccttgcatattttatgcattgt |
19265561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 393 - 425
Target Start/End: Complemental strand, 291426 - 291394
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
291426 |
gtttgaaccccggaccttgcatatattatgcat |
291394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 655742 - 655786
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
655742 |
gtggccggggttcgaaccccggaccttgcatatattatgcattgt |
655786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 422
Target Start/End: Complemental strand, 2546250 - 2546210
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
2546250 |
tggtggtcggggtttgaaccccgtaccttgcatatattatg |
2546210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 422
Target Start/End: Original strand, 5040824 - 5040864
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatg |
422 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
5040824 |
tggtggccggagtttgaacaccggaccttgcatatattatg |
5040864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 428
Target Start/End: Complemental strand, 9111111 - 9111071
Alignment:
| Q |
388 |
tcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9111111 |
tcggggttcgaaccccggaccttgcatatattatgcattgt |
9111071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 9977127 - 9977083
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
9977127 |
tggtggtcagggtttgaaccccagaccttgcatatattatgcatt |
9977083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Complemental strand, 10018469 - 10018425
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| |||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
10018469 |
tggtggccggagtttgaaccccgaaccttacatatattatgcatt |
10018425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Original strand, 14918293 - 14918337
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
14918293 |
gtggtcggggtttgaaccccagaccttgtatatattatgcattgt |
14918337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 21029357 - 21029401
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
21029357 |
tggtggtcagaatttgaaccccgaaccttgcatatattatgcatt |
21029401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Original strand, 2726423 - 2726454
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2726423 |
gaaccccggaccttgcatatattatgcattgt |
2726454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 4450317 - 4450286
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4450317 |
gaaccccggaccttgcatatattatgcattgt |
4450286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 8637439 - 8637474
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8637439 |
gtttgaacctcggaccttgcatatattatgcattgt |
8637474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Complemental strand, 8809373 - 8809330
Alignment:
| Q |
385 |
tggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
8809373 |
tggtcggggtttgaacctcggatcttgcatatattatgcattgt |
8809330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 421
Target Start/End: Complemental strand, 9665380 - 9665341
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
9665380 |
tggtggtcggagttcgaaccccggaccttacatatattat |
9665341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 16390488 - 16390453
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16390488 |
gtttgaaccccggaccttacatatattatgcattgt |
16390453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 18253341 - 18253376
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18253341 |
gtttgaaccctggaccttgcatatattatgcattgt |
18253376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 24373712 - 24373747
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24373712 |
gtttgaacccctgaccttgcatatattatgcattgt |
24373747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 31971588 - 31971553
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31971588 |
gtttgaacctcggaccttgcatatattatgcattgt |
31971553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 425
Target Start/End: Complemental strand, 32621442 - 32621399
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcat |
425 |
Q |
| |
|
|||||||||| ||||||| |||||||||| |||||||||||||| |
|
|
| T |
32621442 |
tggtggtcggggtttgaatcccggaccttacatatattatgcat |
32621399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 33976303 - 33976268
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33976303 |
gtttgaaccccggaccttgcatattttatgcattgt |
33976268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 247729 - 247683
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
247729 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
247683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 4826360 - 4826314
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| ||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
4826360 |
tggtggccggagtttgaacctcgaaccttacatatattatgcattgt |
4826314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 9367471 - 9367425
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
9367471 |
tggtggtcggggtttgaatcccagaccttgcatattttatgcattgt |
9367425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 12323481 - 12323527
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||| | |||||| |||||||||||||||| |
|
|
| T |
12323481 |
tggtggtcggtgtttgaaccctgaaccttgtatatattatgcattgt |
12323527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 14049875 - 14049921
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
14049875 |
tggtggccggaatttgaacctcagaccttgcatatattatgcattgt |
14049921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 27080689 - 27080735
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
27080689 |
tggtggtcggggtttgaatcccagagcttgcatatattatgcattgt |
27080735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 27834409 - 27834363
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| | ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27834409 |
tggtggtccgggtttgaaccccagaccttgcatatattatgccttgt |
27834363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 28758281 - 28758327
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| |||| ||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
28758281 |
tggtgttcggggtttgaacctcggactttgcatatattatgcattgt |
28758327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 32524411 - 32524457
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| || |||||||||| |||| |||||||||||||||||||| |
|
|
| T |
32524411 |
tggtggttggggtttgaaccctggactttgcatatattatgcattgt |
32524457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 33542798 - 33542844
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
33542798 |
tggtggtcggagtttgaactatgaaccttgcatatattatgcattgt |
33542844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 393 - 426
Target Start/End: Complemental strand, 8639105 - 8639072
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
8639105 |
gtttgaaccccggaccttgcatatactatgcatt |
8639072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 395 - 428
Target Start/End: Complemental strand, 8831264 - 8831231
Alignment:
| Q |
395 |
ttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
8831264 |
ttgaaccccggaccttgcataaattatgcattgt |
8831231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 391 - 428
Target Start/End: Original strand, 12904317 - 12904354
Alignment:
| Q |
391 |
gagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
12904317 |
gagtttgaactccgaaccttgcatatattatgcattgt |
12904354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 384 - 421
Target Start/End: Original strand, 22792933 - 22792970
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattat |
421 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
22792933 |
gtggtcggggtttgaaccccggaccttacatatattat |
22792970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 28898925 - 28898880
Alignment:
| Q |
383 |
ggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||| ||| |||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
28898925 |
ggtggccggggtttgaactccggacctttcatatattatgcattgt |
28898880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 5937700 - 5937656
Alignment:
| Q |
384 |
gtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| || ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
5937700 |
gtggtcagattttgaaccccggacctttcatattttatgcattgt |
5937656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 9392659 - 9392703
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||| ||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
9392659 |
tggtagtcggggtttaaacctcggaccttgcatatattatgcatt |
9392703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 394 - 426
Target Start/End: Complemental strand, 12184566 - 12184534
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
12184566 |
tttgaaccacggaccttgcatatattatgcatt |
12184534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 380 - 428
Target Start/End: Complemental strand, 26400936 - 26400888
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| ||| ||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
26400936 |
gttggtggccggggttcaaaccccggaccttgcatatattatgtattgt |
26400888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 27907942 - 27907986
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcatt |
426 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||| ||||||||| |
|
|
| T |
27907942 |
tggtggccggggtttgaaccccagaccttgcatattttatgcatt |
27907986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 428
Target Start/End: Original strand, 72771 - 72812
Alignment:
| Q |
387 |
gtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
72771 |
gtcggagtttgaaccctggaccttgcatatattatgcattgt |
72812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 393 - 428
Target Start/End: Original strand, 1167 - 1202
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1167 |
gtttgaaccccggaccttgcatatattatgcattgt |
1202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 381 - 428
Target Start/End: Complemental strand, 64289 - 64242
Alignment:
| Q |
381 |
ttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||||||| ||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
64289 |
ttggtggtcggggttcgaatcccggaccttgcatatattatgcattgt |
64242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 40381 - 40335
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
40381 |
tggtggtcggagtttgaacctcggaccatgcatattttatgcattgt |
40335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 53371 - 53417
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
53371 |
tggtggtcggggtttgaaccccagaccttgcatattttatgcattgt |
53417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 73511 - 73557
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| | |||||||||| |
|
|
| T |
73511 |
tggtggtcggagtttgaaccccggacattgcatacactatgcattgt |
73557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 161211 - 161165
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
161211 |
tggtggtcggggtttgaaccccgaaccttgcatattttatgcattgt |
161165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1619 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1619
Description:
Target: scaffold1619; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 428
Target Start/End: Complemental strand, 1090 - 1055
Alignment:
| Q |
393 |
gtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1090 |
gtttgaatcccggaccttgcatatattatgcattgt |
1055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 428
Target Start/End: Complemental strand, 75380 - 75349
Alignment:
| Q |
397 |
gaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
75380 |
gaaccccggaccttgcatatattatgcattgt |
75349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0350 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0350
Description:
Target: scaffold0350; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 1318 - 1272
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||| |||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
1318 |
tggtggccggagtttgaactccagaccttacatatattatgcattgt |
1272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 5252 - 5206
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| || ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
5252 |
tggtggttggggtttgaacctcagaccttgcatatattatgcattgt |
5206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Original strand, 14177 - 14223
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
14177 |
tggtggtcggggtttgaaccacataccttgcatatattatgcattgt |
14223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 394 - 428
Target Start/End: Original strand, 42337 - 42371
Alignment:
| Q |
394 |
tttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
42337 |
tttgaaccccagaccttgcatatattatgcattgt |
42371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 428
Target Start/End: Complemental strand, 7792 - 7746
Alignment:
| Q |
382 |
tggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
7792 |
tggtggtcggggtttgaacctcggaccttgcatgttttatgcattgt |
7746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 380 - 428
Target Start/End: Complemental strand, 48719 - 48671
Alignment:
| Q |
380 |
gttggtggtcggagtttgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
||||||| ||| ||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
48719 |
gttggtgtccggggtttgaatcccggactttgcatatattatgcattgt |
48671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 396 - 428
Target Start/End: Complemental strand, 122947 - 122915
Alignment:
| Q |
396 |
tgaaccccggaccttgcatatattatgcattgt |
428 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
122947 |
tgaaccccagaccttgcatatattatgcattgt |
122915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University