View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2517_high_9 (Length: 239)
Name: NF2517_high_9
Description: NF2517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2517_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 38440553 - 38440761
Alignment:
| Q |
17 |
caatgagagatgtggtatctgctgctacaaggttgaacttgataggaccccttggtgcagcattgttgcagcatcaagttgctcctattgctgaaattat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
38440553 |
caatgagagatgtggtatctgctgctacaaggttgaacttgataggaccccttggtgcagcattgttgcaacatcaagttgctcctattgctgaagttat |
38440652 |
T |
 |
| Q |
117 |
attagaaaaatggatgaatcgtgatgttgaggaagcatgtcaaactatgcctcttctagatactgtgcaaggttgtcatggttacttgttttcaagattg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38440653 |
attagaaaaatggatgaatcgtgatgttgaggaagcatgtcaaactatgcctcttctagatactgtgcaaggttgtcatggttacttgttttcaagattg |
38440752 |
T |
 |
| Q |
217 |
ttttcatct |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
38440753 |
ttttcatct |
38440761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 31 - 225
Target Start/End: Original strand, 38448956 - 38449148
Alignment:
| Q |
31 |
gtatctgctgctacaaggttgaacttgataggaccccttggtgcagcattgttgcagcatcaagttgctcctattgctgaaattatattagaaaaatgga |
130 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38448956 |
gtatctgctactaaaaggttgaacttgataggacct-ttggtgcagcattgttgcaatatcaagttgctcctattgctgaagttatattagaaaaatgga |
38449054 |
T |
 |
| Q |
131 |
tgaatcgtgatgttgaggaagcatgtcaaactatgcctcttctagatactgtgcaaggttgtcatggttacttgttttcaagattgttttcatct |
225 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
38449055 |
tgaatcgagatgttgaggaagcatgtcaaactatgcctcttctagacactgtgcaa-gttgccatggttacttgttttcaagactgttttcatct |
38449148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University