View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2517_low_11 (Length: 235)
Name: NF2517_low_11
Description: NF2517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2517_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 44678545 - 44678747
Alignment:
| Q |
17 |
atacttttgattcctaatatttttattttagtaagacacacaatggaggacatgcacaactcttcaagacatttcgtaaaactgtccaaatttgagtaag |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44678545 |
atacttttgattcctaatatatttattttagtaagacacacaatggaggacatgcacaactcttcaagacatttcgtaaaactgtccaaatttaagtaag |
44678644 |
T |
 |
| Q |
117 |
acatgcaatctaccacaatgtcctcaaaataaaacaatctagatcatatattgctttttactattgtaatgtagaaatccgctctaaaattacaccttaa |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44678645 |
acatgcaatctaccagaatgtcctcaaaataaaacaatctagatcatatattgctttttactattgtaatgtagaaatccgctctaaaattacaccttaa |
44678744 |
T |
 |
| Q |
217 |
aat |
219 |
Q |
| |
|
||| |
|
|
| T |
44678745 |
aat |
44678747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University